Transcript asmbl_32444

Sequence
Transcript Sequence for observation asmbl_32444 of TGE0005017:
AGAGAACACTTTTCATTATGGCCAAGTGTAATTTTCCTCAGTATTTTCTTGGAAATGTTATTGAGGGATGGGGGTCCTTTTACAAATTTTGGAAATAAATAAGATGAGAAGACCATGCTTCTGAATGATCATTTAGTTTAAGAAAACCCCTTGATTTAATGTGATTATGGATATGTTGGCTGGAGTGTAGTTTAAGATCTTCCCACTGAACCTACAGGCTTTAAGAAACCAACCCAGGAGTGTATTTTCCTGTCGAACAAATGGGTTCCGAGACCATACCTGTAATTGATCCTATCTCTCTGCTTCTCCTGAGCTAGGCAATGGATCACTTGGAGTCCTTCATTGCTGAATGTGATCGGAGAACTGAGCTTGCCAAGAAGCGGCTGGCAGAGACACAGGAGGAGATCAGCGCAGAAGTTTCTGCAAAGGCAGAAAAAGTACATGAGTTGAATGAAGAAATAGGAAAACTTCTTGCTAAAGCTGAGCAGCTGGGAGCTGAAGGAAATGTGGATGAATCCCAGAAGATTCTTATGGAAGTGGAGAAAGTCCGTGCAAAGAAAAAAGAAGCTGAGGAAGAATACAGAAATTCCATGCCTGCATCCAGTTTTCAACAGCAGAAATTGCGTGTCTGTGAAGTCTGCTCTGCTTACCTTGGCCTCCATGACAATGACCGTCGCCTTGCAGACCACTTTGGGGGCAAATTGCACTTGGGGTTCATTCAGATCCGTGAGAAACTGGATCAGTTGAGGAAAACTGTGGCTGAAAAGCAGGAGAAGAGAAATCAGGATCGCTTGAGGAGGAGAGAAGAGAGGGAGCGGGAGGAGCGGCTGAGCAGGAGGTCTGGCTCAAGAACCAGAGAGCGCAGGAGGTCACGTTCCCGGGACCGGCGTCGGAGGCGGTCAAGATCTACCTCCAGAGAGCGACGAAAGTCTTCCCGGTCCCGGTCCCGTGACAGACACCGGCGCCACCGCAGTCGTTCCCGGAGCCACAGCCGGGGCCACCGCCGGGCTTCCAGGGACCGGAGTGCGAAATACAAGTTCTCCAGAGAGCGGGCGTCGAGGGAGGAGTCCTGGGAGCGCGGGCGGAGCGAGCGGGGGGCCACCGACTGGAGGCTCGAGAGCTCCAACGGGAAGACGGCTTCGCGGAGGTCGGAGGAGAAGGAGGCTGGCGAGATCTGAACCCATGCCCAGGCACTGTAAATAGTCTGATAAACGTTCAACATGCCTGAGGTTACTCTTTATATTTGCTGAATACAACTCATCTTTTGTAGTTTAAAATTTCTATTGTTTCAGAGCTAGCTGTGAGTTTCTAGAGATGTACAGTTGCTCCTGTGTTCTGGGGTTATGTCGAGTAGGAATAAAT