Transcript asmbl_17486

Sequence
Transcript Sequence for observation asmbl_17486 of TGE0000446:
CGGGCCCGCGGGGGAGGATCGTGAGGCCGCCGCCGCCACCGGAACGCTGAGGTTCGGGTCCGGCCGTGAGGCCTAGAGGCTCCGCCGCCGCGGAACCGGAGGGACCCCGTACCGGACAGCCGTCGCCCCAGGCTCCCCGCAGCTGCCCGGACCTCCCCCTGCACGTCCCGGTCCCGCCGCCCGCCCCCGCTGCGGCCACCTCGCCCGTCTCCCGCCCCTCCAAGCCACAGATCATCTTTGGATTCTTCCCCAGAAGCTTCAAGTAGGGATATGTCCTCAGCACCAACTACTCCTCCATCAGTGGATAAAGTAGACGGATTTTCTCGGAAGTCCGTCAGAAAAGCCAGACAGAAGAGGTCGCAAAGTTCCTCACAGTTTAGGTCTCAAGGCAAGCCTATTGAGTTAACACCTCTGCCGCTGCTAAAAGACGTTCCATCCTCAGAGCAGCCTGAACTGTTCCTAAAGAAACTTCAGCAGTGCTGTGTCATTTTTGACTTCATGGACACGCTATCTGATCTTAAAATGAAAGAATACAAGCGCTCCACTCTTAATGAACTGGTGGACTACATTACAATAAGCAGAGGCTGTTTGACAGAGCAGACTTACCCTGAAGTAGTTAGAATGGTATCTTGCAATATATTCAGAACTCTCCCTCCTAGTGACAGCAATGAATTTGATCCAGAAGAAGATGAACCTACCCTTGAGGCATCGTGGCCACACTTACAGCTTGTATATGAATTTTTCATACGATTTTTGGAAAGCCAAGAATTCCAACCCAGCATTGCCAAAAAATATATAGATCAGAAATTTGTATTACAGCTTCTGGAGCTATTTGACAGCGAAGACCCTCGGGAACGGGACTACTTAAAAACAGTCTTACACAGAATTTATGGCAAGTTTCTTGGTCTTAGAGCATTTATCCGAAAACAGATTAACAATATTTTTCTAAGGTTTGTTTATGAAACAGAACACTTCAATGGTGTAGCTGAACTGCTGGAAATATTAGGAAGTATTATCAATGGCTTTGCTTTACCTCTTAAGGCAGAACACAAACAGTTTCTGGTGAAAGTATTGATCCCTTTACACACTGTCAGGAGCTTATCACTCTTCCATGCACAGCTGGCATATTGTATAGTACAGTTTCTGGAGAAAGATCCTTCACTCACAGAACCAGTTATTAGGGGGTTAATGAAATTTTGGCCTAAAACATGTAGTCAAAAAGAGGTCATGTTCCTTGGGGAACTGGAAGAAATATTGGATGTGATTGAACCTTCACAATTTGTTAAAATCCAAGAACCTTTGTTTAAACAAATCGCCAAGTGTGTATCTAGCCCCCATTTTCAGGTGGCAGAAAGAGCACTCTATTATTGGAATAATGAATACATCATGAGT