Transcript asmbl_31292

Sequence
Transcript Sequence for observation asmbl_31292 of TGE0004925:
ATAAGCCTTCTTCCTCCGCCCCCTGGCTCTTTTCTCTCTGGCCTGTCCCCGCCTCCTCCAGTGCCTCCACTCCCCGCTACCCAGGAAGGCCGTGTGGGTTACGCGCGCTGCTTTCGCTTTCCCTTGGCGGTGCCCACTCCTCGCTCCTCGTGAGGCGCTAGGCCCCCTGCCCCTGCCATGGCCATGCTCAGGGTCCAGCCTGAAGCCCAAGCCAAGGTCGATGTGTTCCGTGAAGACCTGTGTACCAAGACAGAGAACCTGCTCGGAAGCTATTTCCCCAAGAAGATTTCTGAGTTGGATGCATTTTTAAAGGAGCCAGCACTCAATGAAGCCAGCCTGAGCAATCTGAAAGCCCCATTGGACATCCCAGTGCCTGATCCAGTCAAGGAGAAAGAGAAAGAGGAGCGGAAGAAACAGCAGGAGAAGGAAGACAAGGATGAAAAGAAAAAAGGGGAAGACGAAGACAAAGGTCCTCCCTGTGGCCCAGTGAACTGCAATGAGAAGATTGTGATCCTTCTACAGCGCCTAAAGCCTGAAATCAAGGATGTCATTGAGCAACTTAACCTCGTCACCACCTGGTTGCAGCTGCAGATCCCTCGGATTGAGGATGGAAACAATTTTGGAGTGGCTGTCCAGGAGAAGGTGTTTGAGCTGATGACCGCCCTTCACACCAAGCTGGAAGGCTTTCACACTCAAATCTCCAAGTATTTCTCTGAGCGGGGTGATGCCGTGACCAAAGCAGCCAAGCAGCCCCATGTGGGTGATTATCGGCAGCTGGTGCACGAGCTGGATGAGGCAGAGTACCGGGACATCCGGCTGATGGTCATGGAGATCCGAAATGCTTATGCTGTGTTATATGACATCATCCTGAAGAACTTCGAGAAGCTCAAGAAGCCCAGGGGAGAAACAAAGGGAATGATCTATTGAGAGCCTTTTCTCATACTGTGATGGGTCCAGCAGAGACCTTCCTATCTTCGACAGGGCACTCCAAACTTTGTCCCACCTTCCACCTATTGAGTTCTCTTCCCCTCCCCAACCCCCTTGCCTCCTAGGCACAATAAATAGAGTCCTAGTGGTACCC