Transcript asmbl_30989

Sequence
Transcript Sequence for observation asmbl_30989 of TGE0004902:
CTTCGAAGTCCGTGCTCCGCCTTCGAAGTCCGTGCTCCGCGCTAGGCCAGTGCCATGGCGGTAGTGGCGGCCCTTCTGCGCGGCTGTGTCCGCCGGTGCAGCCCCCTGCTTCGGCTACAGATGCAGGAAATAAGTTATGTAAAACGAAGTTATGTATCAAAACCCACTTTGAATGAAGTGGTAATAGTAAGTGCTATAAGAACACCCATTGGATCCTTTCTAGGCAGCCTTTCCTCCCTGCCAACCACTAAGCTTGGTTCCATTGCAATTCAGGGAGCCATTGAAAAGGCAGGGATTCCAAAAGAAGAAGTGAAAGAAGCATACATGGGTAATGTTCTACAAGGAGGTGAAGGACAGGCGCCTACTAGGCAAGCAGTACTAGGTGCAGGCTTACCAGTATCTATTCCATGTACCACTATAAACAAAGTGTGTGCCTCAGGAATGAAAGCCATTATGATGGCTTCTCAGAATCTTATGTGTGGACATCAGGATGTGATGGTGGCAGGTGGGATGGAGAGCATGTCCAACACTCCCTATGTAATGAACAGAGGAGCAACACCGTATGGTGGGGTAAAGCTTGAAGATTCAATAGTAAAAGATGGGCTAACCGACGTCTACAATAAAATTCATATGGGCAACTGTGCTGAGAATACGGCAAAGAAGCTGAATATTGCACGAGATGAACAGGATACTTATGCTATTAACTCCTACACCAGAAGTAAATCAGCATGGGAAGCTGGAAAATTTGGAAATGAAGTTATTCCTGTCACAATTACAGTAAGAGGCAAACCAGATGTAGTGGTGAAAGAAGATGAAGAATATAAACGTGTTGATTTCACTAAAGTTCCAAAACTGAAGACAGTATTCCAAAAAGAAAACGGTACAGTAACAGCTGCCAATGCCAGCACACTGAATGATGGAGCAGCTGCTATGGTTCTGATGACTGCAGATGCAGCCAAGCGACTCAACGTTAAACCACTGGCAAGAATAGCAGCATTTGCTGATGCTGCTGTAGACCCTATTGATTTTCCAATTGCACCTGCATATGCTGTACCTAAGGTTCTTAAAGATGCAGGATTGAAAAAAGAAGATATTACAATGTGGGAAGTAAATGAAGCCTTTAGTCTCGTTGTACTAGCAAACATTAAAATGCTGGAGATTGATCCTCAAAAAGTGAATATCCATGGAGGAGCTGTTTCTCTGGGACATCCAATTGGGATGTCTGGAGCCAGGATTGTCATTCATTTGGTTCATGCTTTGAAGCAAGGAGAATATGGTCTTGCCAGTATTTGCAATGGAGGAGGAGGTGCTTCTGCCATGCTGATCCAGAAGCTGTAAGACAACAACCTCTGTTGTCTAAGGAGACAATCCTATGTGGCTAGAAAGGCCTGCTGTAATCAGTGTGACTACCTTGGGTCAGCTTGTTCTCAAAATAACATTACGTTTTTAAATTATTTTCTATTTTAACTTTTTTTATAAGGGGAAAAGATCAAATCTCAAAACCTTTTGAAATTACAAATAAATTTTTTCTTCTACTTTAAA