Transcript asmbl_3095

Sequence
Transcript Sequence for observation asmbl_3095 of TGE0004844:
CAGGGGTTGTGGTGGAGGCGGAGGCTCAGGCTGCGTGAGTGGGCGTTGTATTGAGAGTAAAGAAGGAGGCCTTCCTCTTTGAACAAGATTACCTATTAAAGAGGTACCCTAAAATCTTTCCAGGTCTTGCTATTTGGGGAGCTACAAAGAAAAAACAAATTAAAGGAAGGTTGGTCTTTTAAGTGGACATGGCTCAGATATCCAGCAACAATGGATTTAAGCAATGTTCGTCTTCACATCTGGAACCACCAAGACCAAAAGATGTGGACAAAGAAGAAGCATTACAGATGGAAGCAGAGGCTTTAGCAAAACTGCAAAAAGACAGGCGAGTGACTGATAATCAGAGAGGCTTCGAGTTGTCAGGCAGCACCAGACAAAAAGCACAAGTTTATAACAAACAAGATTATGATCTCATGGTGTTTCCTGAATCAGATACCCAAAAAAGAGCAGTAGATATTGATGTAGAAAAGCTCACCCAAGCTGAACTGGAGAAACTATTGCTAGATGACAGTTTTGAGACAAGGAAAACACCTGTATTGCCAGTTACTCCTGCCCTGAGCCCTTCGTTTTCAGCACAGCTTTATCTTAGACCTACTACTCTTCAGAGGGGACAGTGGCCAACTGGTTTATCTGGGCCTTCAGCTTATACTTTACCTTCTATTTATCAGTCAACTTACAGCAGTAAACAGACTACATTCCAAAATGGCTTTAATCCAAGAATGCCTACTTTTCCATCCACAGAACCGATATATTTAAGTCTTCCAGGACAGTCTCCATATTTTTCATATCCTTTGTCACCTACTACATCTTTTCATCCACAAGGAAGCTTACCTGTCTATCATCCAGTAGTCAGTCCTGACATGGCAAAGCTGTTTGACAAAATAGCTAGTACATCAGAGTTTTTAAAAAATGGAAAAGCAAGGACTGATTTAGAGATAAATTCAAAAACTACAATCAGCAGCCTACAGGTATCTCCAAAGTCTGAAGATATCAGTAAATTTGACTGGTTAGACTTGGATCCTCTAAGTAAGCCTAAGGTGGACAATGTGGAGGTATTAGACCATGAAGAAGAGAAAAATGTTCCAGGTTTGCTAGCAGAGGATCCTTGGGATGCTGTTCTTCTTGAAGAGAGATCATCAGCAAGTTGTCACCTTGAAAGGAAGGTGAATGGAAAATCTCTTTCTGGGGCAGTGGTAACAAGAAGCCAGTCTTTAACTATTCGAACAACTCAGCTTACAAAAGTCCAGGGCCAAATATCTCAGAAAGACCCAAATGGGACCAGTAGTTTGCCAACTGGAAGTTCTCTTCCACAGGAATTTGAAGTACGGAATGAAGAAGTGGCAGCTTTTTGTCGATCCATTACAAAATTGAAGACCAACTTTCCATACACCAATCACTGCACAAATCCAGGCTATTTATTAAGTCCAGTCACAGTGCAAAGAAACATATGTGGAGAAAATGCTAGCGTGAAGGTCTCCATTGAAATTGAAGGATTTCAACTACCAGTTACTTTTACATGTGATGTGAGTTCTACTGTAGAAATCATTATAATGCAAGCCCTTTGCTGGGTGCATGATGACTTGAATCAAGTAGATGTTGGCAGCTATGTTCTGAAAGTTTGTGGTCAAGAGGAAGTGCTACAGAATAATCATTGCCTTGGAAGTCATGAACATATTCAAAACTGTCGAAAATGGGACACAGAGATTAAACTACGACTTTTGACCTTCAGCACAATGTGCCAAAATCTGGCCCGAACTGCAGAAGATGATGAAACACCTGTGGATTTAAACAAACACCTGCATCAAATAGAAAAACCATATAAAGAAGTCATGACAAGACACCCTGTTGAAGAACTTTTAGATTCTTATCATAATCAAGTGGAGCTGGCTCTTCAAGTAGAAAACCAGCACCGAGCAGTAGATCAAGTAATTAAAGCCGTAAGAAAAATCTGTAGTGCTTTAGACGGTGTAGAGACTCTTGCCATTACAGAATCAGTAAAGAAGCTAAAGAGAGCAGTTAATCTTCCAAGGAGTAAAAGTGCCGATGTGACTTCACTGTCTGGAGAAGGAGACACTAGCAAGAGTTCAACTCGGGGCTCACTGAATCCTGAAAATCCTGTTCAAGTAAGCATGGACCAATTAACTGCAGCAATTTATGATCTTCTCAGACTCCATGGAAATTCTGGTAGGAGTCCTGCAGACTGCATCCAAAGTAACAGGAACATCAAGGAAGCGTGGACTACAGCAGAACAGCTCCAGTTTACTGTCTTTGCTGCACATGGAATTTCAAGTAACTGGGTATCAAATTATGAAAAATACTACTTGATATGTTCACTGACTCACAATGGAAAGGATCTTTTTAAACCTATTCAATCAAAGAAGGTTGGCACTTACAAGAATTTCTTCTATCTTATTAAATGGGATGAACTAATCATTTTTCCCATCCAGATATCACAGTTGCCATTAGAATCTGTTCTTCACATTACTCTTTTTGGAATTTTAAATCAGAGCAGTGGAAGTTCCCCTGATTCTAATAAGCAGAGAAAGGGGCCAGAAGCTTTGGGTAAAGTTTCTTTACCTCTTTTTGATTTTAAACGGTTTTTAACATGTGGAACTAAGCTTTTATACCTTTGGACTTCATCACATACAAATCTGATTCCTGGAACAGTTCTCAAAAAAGGATATGTGATGGAAAGAATAGTGTTACAGGTTGATTTTCCTTCTCCTACATTTGATATCATTTATACCACTCCTCAAGTTGACAGAAGCATTATACAGCAGCACAACTTAGAAACATTGGAAAATGATATAAAAGGGAAACTTCTTGATATTCTTCACAAAGATTCATCGTTTGGACTTTCTAAAGAAGACAAAACCTTTTTGTGGGAGAAACGTTATTATTGCCTGAAACACCCAAATTGTCTTCCTAAAGTACTAGCAAGTGCCCCAAATTGGAAATGGGTTAATCTTGCCAAAACTTACTCATTGCTTCAGCAGTGGCCTCCATTGCACCCACTGACTGCATTAGAGCTTCTTGATTCAAAATTTGCTGATCAAGAAGTGAGGTCCCAAGCTGTGACCTGGATCGAGCCTATTAGTGATGATGAGCTAACAGATCTTCTTCCACAGTTTGTGCAGGCTTTGAAGTATGAAATTTATTTGAACAGTTCATTAGTGCGCTTCCTTCTGTCCAGGGCATTGGGAAATATACAGATAGCACACAATTTATATTGGCTCCTCAAGGATGCCCTGCATGATGCACAGTTTGGTGCCCGATATGAACATATCTTGGGTGCTCTCCTCTCAGTAGGAGGAAAAGGACTGAGAGAAGAACTCTTGAAGCAGACAAAACTTGTACAGCTTTTAGGAGTAGTAGCAGAAAAAGTAAGGCAGGCTAGTGGATCAGCCAGACAGGTTGTCCTCCAAAGGAGTATGGAACGAGTACAGTCTTTTTTTCTAAGAAATAAATGTCGCCTGCCTCTCAATCCAAGTCTTGTGGCAAAAGAATTAAATATTAAGTCATGTTCCTTCTTCAGTTCTAATGCTGTGCCCCTAAAAGTCACAATGGTGAATGCTGATCCAATGGGTGAAGAAATTAATGTCATGTTTAAGGTTGGTGAAGATCTTCGGCAAGATATGTTAGCTTTACAGATGATAAAAATTATGGACAAGATCTGGCTTAAAGAAGGACTAGATCTGAGGATGGTAATTTTCAAATGTCTTTCAACTGGCAGAGATCGAGGCATGGTGGAGCTAGTTCCTGCTTCAGATACTCTCAGGAAAATCCAAGTGGAATATGGTGTGACAGGATCCTTTAAAGATAAACCACTTGCAGAGTGGCTGAGGAAATACAATCCCTCTGAAGAGGAATATGAAAAGGCTTCTGAGAATTTTATCTATTCTTGTGCTGGATGCTGTGTAGCCACCTATGTTTTAGGCATCTGTGATCGACACAATGACAATATAATGCTTCGAAGCACAGGACACATGTTTCACATTGACTTTGGGAAGTTCTTGGGCCATGCACAGATGTTTGGTAGCTTCAGAAGGGATCGGGCTCCTTTTGTGCTGACCTCTGATATGGCATATGTCATCAACGGGGGTGAAAAGCCCACCATTCGTTTCCAGTTGTTTGTGGACCTCTGCTGTCAGGCCTACAACTTGATAAGAAAGCAAACAAACCTCTTTCTTAACCTGCTTTCACTGATGATTCCTTCAGGGTTACCAGAACTTACAAGTATTCAAGATTTGAAATACGTTAGAGATGCACTTCAACCCCAAACTACAGATGCAGAAGCTACAATTTTCTTTACTAGGCTGATCGAATCAAGTTTAGGAAACATTGCCACAAAGTTTAACTTCTTCATTCACAACCTTGCTCAGCTTCGTTTTACTGGTCTTCCTTCCAATGATGAACCCATCCTTTCATTTTCACCCAAAACTTACTCCTTTAGACAAGATGGTCGAATAAAGGAAGTCTCTGTTTTCACTTACCATAAGAAATACAACCCAGATAAACATTACATTTATGTAGTCCGAATTTTGAGGGAAGGACAGCTCGAGCCATCATTTGTGTTCCGAACATTTGACGAGTTTCAGGAACTTCACAACAAGCTCAGTATTGTTTTTCCACTTTGGAAGTTACCAGGGTTTCCTAATAGAATGGTTCTAGGAAGAACACACATAAAAGATGTAGCAGCCAAGAGAAAAGTTGAGTTAAACAGTTACTTACAAAGTTTGATGAGTGCTTCAACGGACGTAGCAGAGTGTGATCTTGTTTGTACTTTTTTTCACCCTTTACTTCGTGATGAGAAAGCTGAAGGAATAGCTAGGTCTGCAGATGCAGGTCCCTTCAGTCCTACTCCAGGCCAGATAGGAGGAGCAGTGAAATTATCTGTCTCCTACCGAAATGGTACTCTTTTCATCATGGTGATGCACATCAAAGATCTTGTTACTGAAGATGGGGCTGACCCAAATCCATATGTCAAAACCTACCTACTTCCAGATACCCACAAAACATCCAAACGTAAAACCAAAATTTCACGAAAAACTAGGAATCCAACATTCAATGAAATGCTTGTGTACAGTGGATATAGCAAAGAAACCCTAAGACAGAGAGAACTTCAACTAAGTGTACTCAGCGCGGAATCTCTGCGGGAGAATTTTTTCTTGGGTGGAATAACCCTGCCTTTGAAAGATTTCAATTTGAGCAAAGAGACGGTTAGGTGGTATCAGCTGACTGCAGCAACCTATTTGTAAGCTAGTGAATTTGTGAGCTTTGGAAGCAAGAACAGTTAAAACATGTGTGTGCTT