Transcript asmbl_29968

Sequence
Transcript Sequence for observation asmbl_29968 of TGE0004857:
TTTGCGCTTTTGCTGGAGTCGGTCGTTTTAGAAGTGTCCCTTTCCTGTCGCGAGTTGCGTGGAGTCAGCTCGCGGGTCTCCGAGACTCGAGAACTTGAGAACTTCTTTGCGTCCGGGGGATTGCGCCCCGCGGCTCGGCGGCCGTAATCATGCCACAAAACGAGTATATTGAGTTACACCGTAAGCGCTATGGATATCGTTTGGATTACCATGAGAAAAAGAGAAAGAAGGAAGGTCGAGAAGCTCATGAACGTTCAAAGAAGGCAAAAAAGATGATTGGTCTCAAAGCTAAGCTCTACCATAAACAGCGCCATGCTGAGAAGATACAAATGAAAAAGACTATCAAGATGCATGAAAAGAGAAACACCAAACAAAAGAATGATGAAAAGACTCCACAAGGAGCAGTACCTGCCTATCTACTGGACAGAGAGGGACAGTCCCGAGCCAAAGTACTTTCCAATATGATTAAACAAAAACGAAAAGAGAAAGCGGGAAAATGGGAAGTCCCTCTGCCCAAAGTTCGTGCTCAGGGGGAAACAGAGGTATTAAAAGTTATTCGAACAGGAAAGAGAAAGAAGAAAGCATGGAAGAGGATGGTTACTAAAGTCTGCTTTGTTGGAGATGGCTTTACTCGAAAACCACCTAAATATGAAAGATTCATTAGGCCAATGGGCTTACGTTTCAAGAAGGCCCATGTAACACATCCTGAACTGAAAGCCACCTTTTGCCTGCCAATACTTGGTGTAAAGAAAAATCCCTCATCCCCACTTTATACAACTTTGGGTGTTATTACCAAAGGTACTGTCATTGAAGTGAATGTGAGCGAGTTGGGCCTTGTGACACAAGGAGGCAAGGTTATTTGGGGAAAATATGCCCAGGTTACCAACAATCCTGAAAACGATGGATGCATAAATGCAGTCTTACTGGTTTGACAGTAGTTTCATACAAGTAACTCCTTATAATTATTGAAGACTATGCACCAATCAGGAAAACCATCTTTACCTGTGATGTTTCTGAGTACTACCAAACAGGTTACATGTCTGTACTCATTGACCTATTTATTTTATTGTAAAGAACATTAAAATGGTCCAGTTTTATAAATTGGTCTTTATTTTGGGGTCTGTTTAATGTTTAGATGTTCATGAAATGGAATAATTAAAAAGCAGTTATAGAAATGTCCTGCTTTATCAGTATCTGTATTAGTAAGTAGGTATTCAGGAATGCTAATTTGTCATTACTGGAAAAGCCAGTGTAGTTGAAAACTCCTTTAATCAAG