Transcript asmbl_23899

Sequence
Transcript Sequence for observation asmbl_23899 of TGE0004373:
GTTTCCGTTAGGTACAGGAGGCTGAGGCGCGCGACCCGCCGCAGTCCCACGTGAAGGGCTACGCGAGCATCGCTCGGCGGGACAGCTCCCCGCTCGCCGCGGAGCGTCCCGGAAGCAGCGGGGAACCGGAAGTGGCCCGCGGCAGCTCAGAAGCTGATCCCGGTTCCCGGTGTGTGGCCCCTCGAAGCGCAGCGACGGCGCCATGTCCCTGATCTGCTCGATCTCCAATGAAGTGCCAGAGCACCCGTGTGTGTCCCCTGTCTCTAATCATGTCTATGAGCGGCGGCTCATTGAAAAGTATATTGCAGAGAATGGCACAGACCCCATCAACAACCAGCCTCTGTCCGAAGAGCAGCTCATCGACATCAAAGTTGCTCACCCAATCCGGCCCAAGCCTCCCTCAGCCACCAGCATCCCGGCCATTCTGAAAGCCTTACAGGACGAGTGGGATGCAGTTATGCTGCACAGCTTCACTCTGCGCCAGCAGCTGCAGACAACCCGCCAAGAGCTGTCCCACGCGCTGTACCAGCACGACGCCGCCTGCCGTGTCATTGCCCGTCTCACCAAGGAAGTCACTGCTGCCAGAGAAGCTCTGGCTACCCTGAAACCGCAGGCTGGTCTCATCGTGCCCCAGGCTGTGCCGAGTTCACAGCCAAGTGTTGTGGGTGCAGGCGAGCCCATGGATTTGGGTGAACTGGTGGGAATGACTCCCGAGATCATACAGAAGCTCCAAGATAAGGCCACTGTGCTGACCACGGAGCGTAAGAAGAGAGGGAAGACTGTGCCTGAGGAGCTGGTGAAGCCAGAAGAGCTTAGCAAATACCGTCAGGTGGCATCGCACGTGGGCTTGCACAGTGCCAGCATTCCCGGGATCCTCGCCCTGGACCTCTGCCCCTCCGACACCAACAAGATCCTCACTGGTGGGGCGGATAAAAACGTCGTCGTCTTTGACAAGAGTTCTGAGCAGATCCTGGCCACCCTCAAGGGCCACACCAAGAAAGTCACCAGTGTGGTGTTTCACCCTTCCCAGGAGCTGGTGTTTTCTGCCTCCCCAGATGCCACTATCAGGATTTGGTCTGTCCCGAACGCCTCTTGTGTACAGGTTGTTCGGGCCCATGAGAGCTCTGTGACCGGCCTCAGCCTCCACGCCACTGGCGACTATCTCCTGAGCTCCTCTGATGACCAGTACTGGGCCTTCTCTGACATCCAGACAGGGCGTGTACTCACCAAGGTGACAGATGAGACCTCTGGCTGCTCTCTCACCTGTGCGCAGTTCCATCCCGATGGGCTCATTTTTGGAACGGGAACCATGGACTCTCAGATCAAGATCTGGGACTTAAAGGAGCGCACCAACGTGGCCAACTTCCCTGGCCACTCGGGCCCCATCACCAGCATTGCCTTCTCCGAGAATGGCTACTACCTGGCCACCGCGGCCGACGACTCCTCTGTCAAGCTCTGGGATCTGCGCAAGCTTAAGAACTTTAAGACACTGCAGCTGGACAACAACTTTGAGGTGAAGTCGCTGATCTTTGACCAGAGCGGTACCTACCTGGCCCTTGGGGGCACAGATGTCCAGATCTACATCTGCAAACAGTGGACGGAGATTCTTCACTTCACAGAGCACAGCGGCCTGACCACAGGGGTGGCCTTTGGGCACCACGCCAAGTTCATCGCTTCCACGGGCATGGATAGGAGCCTCAAGTTCTACAGCCTGTAGGCCCTGTCCCCTCTGACGCAAGCTGAACCTCATCTCAGTAGTGGGGTAGAGTTAGGGTTGGG