Transcript asmbl_29568

Sequence
Transcript Sequence for observation asmbl_29568 of TGE0002767:
CAGGAGAAGAAACTAAGACCTGGAGTTTGAGTAATTCTTTCAAAGCTACCGAGTTGATAGAGGGACGAGAACAGAATCACCAGCACTGGCTGAAGGTACCTTAACATGGGGAATCTTCTTAAAGTTTTGACATGCACAGACCTTGAGCAGGGGCCAAATTTTTTCCTTGATTTTGAAAATGCCCAGCCTACAGAGTCTGAGAAGGAAATTTATAATCAGGTGAATGTAGTATTAAAAGATGCAGAAGGCATCTTGGAGGACTTGCAGTCATATAGAGGAGCTGGCCATGAAATACGAGAGGCAATCCAGCATCCCGCAGACGAGAAGTTACAGGAGAAAGCATGGGGCGCGGTCGTTCCGCTCGTAGGCAAATTAAAGAAATTCTATGAATTTTCTCAGAGGTTAGAAGCAGCATTAAGAGGTCTCCTGGGAGCCCTGACAAGTACCCCGTATTCTCCCACCCAGCATCTAGAGCGAGAGCAGGCTCTTGCTAAACAGTTTGCAGAAATTCTTCATTTCACACTCCGGTTTGATGAACTCAAGATGACAAATCCTGCCATACAGAATGATTTCAGCTATTACAGAAGAACGTTGAGTCGCATGAGGATTAATAATGTTCCAGCAGAAGGAGAAAATGAAGTAAATAATGAATTGGCAAATCGAATGTCTTTGTTTTATGCTGAGGCAACCCCAATGCTGAAAACCTTAAGTGATGCCACCACAAAGTTTGTATCAGAGAATAAAAATTTACCAATAGAAAACACCACAGATTGTCTAAGCACCATGGCTAGTGTATGCAGAGTCATGCTGGAAACACCGGAATACAGAAGCAGATTCACAAATGAAGAGACGGTGTCATTCTGCTTGAGGGTTATGGTGGGCGTCATAATACTCTATGACCACGTACACCCCGTGGGAGCGTTTGCCAAAACTTCAAAAATCGACATGAAAGGTTGTATCAAGGTTCTTAAGGACCAGCCTCCTAATAGTGTAGAAGGTCTTCTCAACGCCCTCAGGTACACAACAAAACATTTGAATGATGAGACTACCTCCAAGCAAATTAAATCCATGCTGCAATGACACTTCTGGAATAAGCACCTGCTGTAGACAGAAGACAGTATTCTGCAGTGACTGAGAATGCACAGTTTTTTAGTGATTGCAATTACTATCTCATTTACTCTTGCTTTTTATTTCTTTCCTCTGTTCCTCTTCCCTCTTTTTTAATCATGTTCTTGTTCTTAAGACTTCTTTTCTGTGCCAAAATCAGTAAAGTTATACTCTGAAGGGATATTGTCCTTTCAAACAGGCCGTCTAAGGCAGCTAATTATGCATTGCATTGGGGTCTCTACTGAGAGAAATTCTGTGACTTGAACTAAATATTTTTAAATGTGGATTTTTTTTGAAAACTAATATTTAATATTGCTTCTCCTGCATGGCAAAACTGCCTATTCTGCTATTTAAAAACCCTCAATGACTTTATTTTCTACTGCCGCTTTTTTCATGTGCAGCCAAAATGAAAATGTTTAAATTAACTGTGTTGTACAAATGGTACCCAACACAACCTTTTTTTAAATTAGTAAGACTTTTGTTTAAAGTTTTAAGTTTGCATTTTCACTTTTTTGTAAGGATGTATGTTGTGTGTTTAACCTTTATTAACTAACGTTAAAAACTGTGATGTGTGCGTAGAGTATTACGTATGCATGTTCATGTTTAAAGAATGGCTGTTGATAAAATAAAAATCAGCTTTCATTTTTCTA