Transcript asmbl_29246

Sequence
Transcript Sequence for observation asmbl_29246 of TGE0004810:
AAACAGAATTCCTTATCCATTTGAAATAAACATTTCCAAGAAATGAAAGACTTCTTTCACTAGGATATTCTGGTCTGGTTCCATCTTCAGAGAATCTAGTTTTTGACTATGAAAAAGATGAGTTACTGGATCCTGAAGACCATCCCTGGATCTCGGGTTAAAAATCTGTTCTAATCTGAACCGTGGGAAGAAAGGGTCCTTGGTCGGCGGTATTCCCACCTGAAGGACATGATGTTTTCCAAACTAGCACATTTCCAGACCGTTGCCGTGCTGCGTCGAGGAGTTCACTCTTCAGTGGCTTCTGCTACATCCGTTGCGACTAAAAAAACAGTCCAAGGCCCTCTATCCTCTGATTACGTTTTTGAAAGGGAATCGAAATATGGCGCACACAACTACCATCCCTTACCTGTAGCCCTGGAGAGAGGAAAAGGTATCTACCTGTGGGATGTAGAAGGCAGAAAATATTTTGACTTCTTGAGTGCTTACAGTGCTGTCAACCAAGGGCATTGTCACCCAAAGATTGTGAATGCTCTGAAAAGTCAGGCAGACAAACTGACCTTGACATCTAGGGCATTCTATAATGATGTACTTGGTGAATATGAAGAGTATATTACTAAACTTTTCAACTATCACAAAGTTCTTCCTATGAATACAGGAGTGGAGGCTGGAGAGACTGCTTGCAAGCTTGCTCGTAGATGGGGATATACCGTTAAGGGTATTCCGAAATACAAAGCAAAGATCGTTTTTGCAGCTGGAAACTTTTGGGGTAGAACTATGTCTGCTATCTCCAGTTCCACAGACCCAAACAGTTACGAAGGTTTTGGACCATTTATGCCAGGTTTTGAAATCATTCCATATAATGATCTGCCCGCTCTTGAGCGTGTTCTCCAGGACCCGAACATCGCCGCATTCATGGTGGAGCCCGTTCAGGGCGAAGCGGGCGTCATTGTGCCAGACCCGGGCTACCTGACAGGCATCCGTGAGCTCTGCACCCGGCACCAGGTTCTGTTTATTGCTGATGAAATACAGACAGGATTGGCCAGAACTGGTAAATGGCTGGCCGTCGATCATGAAAATGTCAGACCTGATATAGTCCTTCTTGGAAAGGCGCTTTCTGGTGGCTTATACCCTGTGTCCGCAGTACTGTGTGATGATGAAATAATGCTGACCATCAAACCAGGGGAGCATGGGTCAACGTTTGGTGGCAACCCGCTGGGCTGCCGAGTGGCCATGGCAGCCCTCGAGGTTTTGGAAGAAGAAAACCTTGTTGAAAATGCAGATAAAATGGGTACCATCTTGAGAAACGAACTCATGAAGCTACCATCTGATATCGTAACTGCTGTAAGAGGGAAAGGATTATTAAACGCTATTGTTATTAGAGAAACCAAAGATTACGATGCTTGGAAGGTGTGTCTGCGACTTCGAGATAATGGACTTCTGGCCAAGCCAACCCACGGCGACATTATCAGGTTTGCACCTCCGCTTGTGATCAAGGAAGACGAGGTTCGGGAGTCCATGGAAATCATTAACAAGACCATCTTGTCTTTCTGAGGGTTGCGACTGTTTTCGGCGGTGCCTGTGAGTCAGCTGGAGACAGGCAGACAGTTCCTTGAAGTCCTGTAAAAAGCTTCTGCATTTTTGTGTGTGATGCAGGCACATTCCACTCCCTGTGTCTTCAAGGACTTATTTTTTAATATACATATTTTTCAGTTCATACATAATAGAGTGACATTTATAATCGTGCAGTATGCCATTTAACATAACTGTAAGAGAATGTAATGACATCTATATTCGATTGTTTTTGTGTACTTGTGTACTTTCTGAAGTGAAATGCATCTATTTGTCTGTCTGTAGGCAGCCTTACAATCAAGCCCCATATAACTTATATATGTTTTTATAATTTCTGGTGTAAATGTTTTATATTTGAAAAAGTTATATGGGGTTTTACATAAAAGACTTCTTTAACCTTATGAAGCTGAATTATAATCATTGAATTTTAGGAAGGTTAAGCTTATATAAAACACTAGATTTAAATAAACTTCATATTGGCCAACATCAGAATATATTCCATGAGTGTCATTATTTTGAATTAATAATTAATATTTAACATTCCCAAATTATT