Transcript asmbl_28956

Sequence
Transcript Sequence for observation asmbl_28956 of TGE0004797:
CTTCAAGCCTTGAAGAGCCCCTGCTGCTGTTATGAAACAATAGCAGAAATGGCCTGCAAAGCCTAAAATACTTATTGTCTGGTAATTTACAAAAAAGCTCACTGACCCCTGGCTCCAGAATGCCCAAGATCTGGTCTCCTGTTTCTCCGGTCTCCAAGTTTGGAGAAGCCCCTGGCCTAGATGGGCAATGCCATGAAAACAATATCAGGAAGAAAGGGGAGAAAGATAAACATCTAGGAGGGTTGGGCAGCCACAGAGCTAGACCTGCCCGGCACAAGTGAAAGTGGGGCTGCTCTCTCACCCCGATCTTCCCCGTTGCTGGCTGGTGCTGCTGTAGCTCTCCCTAAACATGGCCAACAAGGGACCTTCCTACGGCATGAGTCGTGAAGTGCAATCCAAAATTGAGAAGAAGTACGACGAGGAGCTGGAGGAGCGGCTGGTGGAGTGGATTGTGGTGCAGTGTGGCCCTGACGTGGGTCGCCCAGACCGCGGGCGCCTGGGCTTCCAGGTCTGGCTGAAGAACGGCGTGATTCTGAGCAAACTGGTGAACAGCCTGTATCCTGATGGTTCCAAGCCAGTGAAGGTGCCTGAGAACCCCCCTTCCATGGTCTTCAAGCAGATGGAGCAGGTGGCTCAGTTCCTGAAGGCAGCTGAAGACTATGGAGTCACCAAGACTGACATGTTCCAGACTGTTGACCTCTTTGAAGGCAAAGACATGGCAGCAGTACAGAGGACCCTAATGGCTCTGGGCAGCTTGGCAGTGACCAAGAACGATGGGCACTACCGTGGAGATCCCAACTGGTTTATGAAGAAAGCCCAGGAGCATAAGAGGGAATTCACAGAGAGCCAACTGCAGGAGGGAAAGCATGTCATTGGCCTACAGATGGGCAGCAACAGAGGGGCTTCCCAGGCTGGCATGACGGGCTACGGACGACCTCGGCAGATCATCAGTTAGAGGACGAGGGCCAGCCCCCAGTCCTTTCCTGCCCCGGCTCATTGGCTGCAGCCATCTATCCTGCCTAGCCCACCTCACCCACACCCGTGTAATTCCTTCAGCCCCGGCCAAGCTTCGAGTCTCCGAGGCTCTGTCACTGAGCAAAGGTGACTTGCGCTTGGGCAACTCTCCCCACCCTCCTCAGCCTCAGCTGAACTTCTTACCCCAAAGCACTGCTCCCTGGGCCCTCCTTCAACCTCCCACCACCTCTACTGAGCTGAGCAAGGGGGTGTGGGCTGGGGGTGGTCTGGGTGTGGGGCAAGTCCACTGCGCTCCTTGGCAGCAGATGCCCATTGAAGGAGACCCAGCCCAACCTCCCCCCATTTTTTGCTGGAATATTTTGGGGGTTGAAATTCAAGAAGGAAAAAAAAATATATATATATATCTATATCTA