Transcript asmbl_28955

Sequence
Transcript Sequence for observation asmbl_28955 of TGE0004797:
CTTGTGTTGTGGAAGGTGGTTGGGTGGGGAATGCAAGAGGGCAGGGCATAGAAGGTAGTGCTTGACTGGGCCACAGGGATGCATGCAGCCTGACTGGCGGAGAGGGATGGGGGATGCACGGGTAAGCTGAGATGGGACGGGGAGCAGCATACAGGATGGGCTGAAATCACTTGTTCCAGCTGACTGATGGTTTTTGATCATAGCACTTTGCCCAGGAGACTTTGAGTTATTGTGAAGCAGGGGTGAGATACGAAGCAAAGCGGGGGGAATGGGAGGAACTTACTATTTATAGACAAACAGAGCAGAGCCCTCTGCCTTTGGGTTCTCTGGCATCACCGGCTGGGAGAGGGGTGGTGGTACTCAGAGAACCTCATCCTCAGAGGTGGCCCAGCCCTCACTTTATAAATAAGGAAGCAGACCCAGGGAGAAGTGAGTTGCCCAGTGCCTAGAATTTAGATGAATCTGTCTCTTGTTCTTTCTCTCAGACTTTGTTGTCCTCTCATGGCATGATTTTGAAAAGGTGTGGAGGCTGGAGGGGGAAGAACACTTACTATTTTTTTCCCCTTGGTCAGGGGCTGGCTCTCCCAGGTCACTTCCAGGAGATTAGCTCTGGGAGGCACAGGACTGGCATTTGGAGGAGCTCTGCTGAAGGACAGGCAGTATGTTAGGTAGTCACAGACATTGTCTCATCGAACGTTCACAGCCCTCTGGGGTAGATATTTTCCTCACTGAGCAGATGGGGAACTCGAGCTCAGAAAAGTTGTCAGCCGTGGGGAAAGGAAGGTTAGGGCAATGGAGTTTGGCAGGTGACCTGGGACCATGAGAAGTGACGATGTTCACTCTGCTTCCCATGGTAGCTGGTGTGGAGAGGGTCTCAGCAATGACAAGAGAGGGAGTCAGAGGAATGAGCTATTTCCATCCTTAGACCATTCTTTCCTTCCCAACTTGTGACCTCTCTGAGGCCAGGGATGGGTTTGGCCTCATTTGGTACCTCTTCGGATGAACTCTGGGCACCACCCCACGTTGATACCTGTGGCCAGGCTAGGCTCCTCTTGACCAGCCATGCCCATGTCTGCTTGGCATCCACCTACCCGGCCTTGCCCCTGTAGACTTAGCCTCCATCAGTACGGCTCCCTTGAGCAGGGCCAGTCTCGGGCCTTCAGGGCAGCACTTGTTGCTGGTCTGGACAGGCAGGTCCTTGGCTTCAGGTTTTCCCTGGAGGATTTGGCTTCTTGGTTACTCAGGGGAAGCTACTACAGTGGTGAGAAACGGCATGAAGGAAAGTCCATGGGTAGATCAGTTTGCGTTTCTCTCTTTCTCTCTCTTCCCTGTGGCTCCCCTGAGGAAATGCAGCTTCTTGGCCAAGAGCTCTTGGGCTTTGCTGTCTTCCTAGACCTTGCCAGGGGTAGATAAGTTTGAGCCTTTTCAGCTGCAGGCCAGAGGCTGAGCTGACCTGGCAAAGAGCTAGCATTTTTGAGTTCCAGCTTCTGGGCTAGCGGAGACATGAGTTGGAGGTAACCCCATAACCTGAGACAGCCAGTGAACCGCCTCACACCTAGCTGGAAAAAGACACCTGCTGGCTTTATTTTGGGGGACAATGTGGCTTCCTCCAGAAGGCCTCTCCAGTGTATCTGTGGCCAATCTTGGCAAAAAAAGAATGCTCTGGATTAGGGATTGTCAAACTATGGCCCATAGGGTAAACACAGCCTGCTGTTTGTATAAAGTTTTACTGGAACAAAGCCATGCTCATTTGTTTATGTACTGTTTAAGGCTGCTGTTATGAAACAATAGCAGAAATGGCCTGCAAAGCCTAAAATACTTATTGTCTGGTAATTTACAAAAAAGCTCACTGACCCCTGGCTCCAGAATGCCCAAGATCTGGTCTCCTGTTTCTCCGGTCTCCAAGTTTGGAGAAGCCCCTGGCCTAGATGGGCAATGCCATGAAAACAATATCAGGAAGAAAGGGGAGAAAGATAAACATCTAGGAGGGTTGGGCAGCCACAGAGCTAGACCTGCCCGGCACAAGTGAAAGTGGGGCTGCTCTCTCACCCCGATCTTCCCCGTTGCTGGCTGGTGCTGCTGTAGCTCTCCCTAAACATGGCCAACAAGGGACCTTCCTACGGCATGAGTCGTGAAGTGCAATCCAAAATTGAGAAGAAGTACGACGAGGAGCTGGAGGAGCGGCTGGTGGAGTGGATTGTGGTGCAGTGTGGCCCTGACGTGGGTCGCCCAGACCGCGGGCGCCTGGGCTTCCAGGTCTGGCTGAAGAACGGCGTGATTCTGAGCAAACTGGTGAACAGCCTGTATCCTGATGGTTCCAAGCCAGTGAAGGTGCCTGAGAACCCCCCTTCCATGGTCTTCAAGCAGATGGAGCAGGTGGCTCAGTTCCTGAAGGCAGCTGAAGACTATGGAGTCACCAAGACTGACATGTTCCAGACTGTTGACCTCTTTGAAGGCAAAGACATGGCAGCAGTACAGAGGACCCTAATGGCTCTGGGCAGCTTGGCAGTGACCAAGAACGATGGGCACTACCGTGGAGATCCCAACTGGTTTATGAAGAAAGCCCAGGAGCATAAGAGGGAATTCACAGAGAGCCAACTGCAGGAGGGAAAGCATGTCATTGGCCTACAGATGGGCAGCAACAGAGGGGCTTCCCAGGCTGGCATGACGGGCTACGGACGACCTCGGCAGATCATCAGTTAGAGGACGAGGGCCAGCCCCCAGTCCTTTCCTGCCCCGGCTCATTGGCTGCAGCCATCTATCCTGCCTAGCCCACCTCACCCACACCCGTGTAATTCCTTCAGCCCCGGCCAAGCTTCGAGTCTCCGAGGCTCTGTCACTGAGCAAAGGTGACTTGCGCTTGGGCAACTCTCCCCACCCTCCTCAGCCTCAGCTGAACTTCTTACCCCAAAGCACTGCTCCCTGGGCCCTCCTTCAACCTCCCACCACCTCTACTGAGCTGAGCAAGGGGGTGTGGGCTGGGGGTGGTCTGGGTGTGGGGCAAGTCCACTGCGCTCCTTGGCAGCAGATGCCCATTGAAGGAGACCCAGCCCAACCTCCCCCCATTTTTTGCTGGAATATTTTGGGGGTTGAAATTCAAGAAGGAAAAAAAAATATATATATATATCTATATCTA