Transcript asmbl_28757

Sequence
Transcript Sequence for observation asmbl_28757 of TGE0004778:
GCTAACTTCCTTCCTGTTCTAACTGCCAGTACTCAGAAGTCAGAGTTAAGAGACAGAGGCACCCCGGACAGAGACGTGAACAACTGAATATCAAAATGACTGAAAAAGCCCCAGAACCACACCTGGAAGAGGATGATGATGAACTGGACGGCAAGCTCAATTACAAGCCTCCACCTCAGAAGTCCCTGAAAGAGCTGCAAGAGATGGACAAAGATGATGAAAGTCTAGCTAAGTACAAGAAAACACTCCTGGGAGATGGTCCTGTGGTAGCAGACCCAACAGCCCCCAATGTCACTGTCACCCGCCTTACCCTGGTATGTGAGAGTGCCCCAGGACCAATCACCATGGACCTCACTGGGGATCTTGAAGCCCTCAAAAAAGAAATTTTTGTGCTAAAAGAAGGTGTTGAATATAGAGTCAAAATTCACTTCAAAGTGAACAGAGATATTGTGTCAGGCCTAAAGTATGTTCAGCACACCTACCGGACTGGGGTGAAAGTGGATAAAGCCACATTTATGGTTGGCAGCTATGGGCCTCGACCAGAGGAGTATGAATTCTTGACTCCAATTGAGGAGGCTCCCAAGGGCATGCTGGCCCGAGGCACCTACCACAACAAGTCCTTCTTCACCGACGATGACAAGCACGACCACCTCACCTGGGAGTGGAATCTGTCCATTAAGAAGGAGTGGACAGAATGAGCACGTCTGCCCCTTACTGTCCCTACCCTTGGCACTTGGAAGAACCCTCTCAGTCATGTTCACTGCACTGTCCCTTCTCCCTGATCACAGCTGGACCCCTTTCCCAACACCCCCACATCGTCTCTCTGATGCATCTTCTCCCACACTCTCTCAAAGTGGTCCCTGGTACTGGATGCTTAAAACCCAAGCTTCAATCCTGCCCACTCCTTCTGACTCCCATCACGGCCAGACCTTCGAAGTTCTCCACCTCAATACACGATCATTTAATATCTCTTATTCCCATTTGAACAGCTAGAGGCCAGGAAATGGGCGAATGATCACTAATTGTTCTTTTGCCTTCGGTTCCAAGGCTCATTCTCACCCCTGGATTCTTCTGTGGTTGCTGCTGGCTCTATGAAGGTCCCTAGTCACATTCCCTGCCAGATGGGTTCTTCTTTTCTGGGAGACACTGTAAACAGCACAAGAGAGTAAGAATAAAACAATCGTATGATCTGACTGAGA