Transcript asmbl_28389

Sequence
Transcript Sequence for observation asmbl_28389 of TGE0004737:
GGAAAAGCCAGTGTCCTCCCCAGCCTAAGGCCGCGGCGACCGAGCCAGGCGAAGGGACCGGGGTACCCCTCACCCTCCAGGAGCTCTAGAGACCCAGGACCATGGACAATTTCAATAGGAACCAGGTAGGCCCTGGATGCAAGACCCAAGTAATGGTGCAGAAAGGACCATTGGACCTGATTGAGACAGGCAAAGGGCTGAAAGTACAAACAGACAAACCCCATCTGGTGAGCCTGGGCAGTGGGCGACTCAGCACAGCTATCACCTTTCTGCCGCTGGAAGAAGGGAGGACAGTGATTGGCTCTGCAGCCAAGGACATCTCACTGCAGGGTCCAGGCCTGGCTCCAGAGCACTGCTACATCGAGAACCTGCGGGGCACCCTCACCCTCTACCCTTGTGGTAATGCCTGTGCTATTGATGGACTCCCTGTTCGACAGCCCACCCGGCTCACTCAGGGCTGTATGTTGTGCCTGGGTCAATCTACCTTCCTCCGCTTTAACCACCCGGCTGAAGCCAAGTGGATGAAAAGCATGATTCCTGCCGGGGGCCGTACTCCTGGGTCTCCGTACAGTCCTGGCCCAGAATCAGAAAGCCTGGTGAATGGGAACCATACCCCACAGCCTGCAACTCGGGGACCCTCTGCCTGTGCCAGCCACAGTTCCCTGGTGAGCTCAATTGAGAAGGACCTGCAAGAAATCATGGATTCACTGGTGCTAGAGGAACCTGGAGCTGCTGGCAAGAAGCCTGCCACAACTTCCCCACTGTCGCCGATGACTAATGGTGGTCGTTACCTGCTGTCCCCCCCAACCAGCCCTGGTGCCATGTCTGTGGGTTCCAGCTATGAGAACACCTCTCCAGCCTTCTCTCCACTCTCCTCACCAGCCAGCAGTGGAAGCTGTGCCAGCCACTCACCCAGTGGGCAGGAGCCAGCATCTTCCACACCCCCACTAGTGCCTGCCCGTTCCTCTAGCTACCATCTGGCCCTGCAGCCCCCACAGTCCCGACCTAGTGGTGCCCGCTCCTCTGAGAGCCCCCGGCTGGGCAGGAAAGGGGTTCATGAGAGGCCTCCCAGCCCTGGCCTCCGGGGTCTGCTGACAGACAGCCCTGCATCTACTGTCTTGGCGGAGGCCCGCAGAACCACTGAGAGCCCCCGGCTATGTGGGCAGCTGCCTCTGGTGGCTATCAATCTGAGTGAATACTCGGCTTCTGGTGCCCACAGTCAACCCACCAGCATTCCTGGCAGTCCCAAGTTCCAGTCTCCAGTCCCTGCTCCCCGAAACAAGATTGGCACACTTCAGGACCGCCCTCCCAGCCCTTTCCGTGAGCTTCCAGGCGCTGAGCGGGTATTGACAACCAGCCCCTCACGCCAGCTGGTGGGCCGAACATTTTCAGATGGTTCAGCTACCCGCACCCTGCAGCCTCCTGAAAGCCCCTGCCTGGGCCGACGGGGCCTGGACAGTATGCGAGAACTCCCTCCCTTGAGCCCGTCTCTGTCCAGACGAGCTCTCTCCCCCATGCCCTCCCGGAATACTCCAGATCCCAAACTAACTAGGGAAGTGGCAGAGAGTCCCCGGCCGCGGCGCTGGGCAGCCCATGGGACTTCACCAGAGGACTTCTCCCTGACACTGGGGTCGCGGGGCCGGAGGACACGGAGCCCCTCACCCACACTCGGGGAGTCCCTGGCACCCAGCAAGGGCAGCTTCAGTGGCAGGCTGAGCCCAGCTTACAGTTTGGGCTCTTTGACTGGGGCTTCGCCCCGTCAGAGCCCCCGTGCCCAGAGGAAACTCTCCAGCGGGGACTTACGGGTGCCTGTCACTCGAGAGAGGAAAAATAGCATCACGGAGATCAGTGACAATGAGGATGACCTCCTGGAGTACCACCGGCGGCAGCGCCAAGAACGGCTTCGGGAGCAGGAGATGGAGAGGCTGGAACGCCAGCGCCTGGAGACCATCCTGAATCTGTGTGCCGAGTACAGCCGGGCTGATGGGGGACCTGAGGCCGGAGAGCTGCTCAGCATTGGGGAGGCCACTGCAGCATTGGCACTGGCAGGCCGGAGGCCCTCACGAGGCCTTTCAGGAACCACTGGGGCCTCTGGGCGGAACAATGAGGAGCCTGGAAGTGCCACCCAACGCCTGTGGGAGAGTGTAGAACGCTCAGATGAGGAAAATCTCAAGGAGGAGTGCAGTAGCACTGAGAGCACCCAGCAGGAGCACGAAGATGCACCTAACACCAAGCTCCAGGGAGAAGTGTTGGCCCTGGAAGATGAACGGGCTCAGGTGCTAGGGCGAGTGGAGCAGCTCAAGGTCCATGTGAAGGAGCTGGAGCAGCAGCTGCAGGAGTCAGCTCGAGAGGCTGAAATGGAGCGGGCGCTGCTGCAGGGGGAGAGGGAGGCAGAGCGGGCACTGTTGCAGAAGGAGCAGAAAGCAGTGGACCAGCTGCAGGAGAAGCTGGTGACTTTGGAGACAGGCATCCAAAAGGAGAGGGACAAGGAGGCAGAGGCCTTGGAGACTGAGACAAAGCTCTTTGAGGACTTGGAGTTCCAGCAGCTGGAGCGAGAGAGCCGCGTGGAGGAGGAGCGCGAGCTGGCGGGCCAGGGGCTGCTCAGAAGCAAGGCCGAGCTATTCCGCAGCATCGCCAAGAGGAAGGAGCGGCTGGCAGTCCTGGACAGTCAGGCTGGGCAGATCCGGGCTCAGGCTGTGCAAGAGTCTGAGCGCCTGGCCCGGGACAAGAATGCCTCCCTGCAGCTGCTGCAGAAGGAGAAAGAGAAACTGACTATGTTGGAAAGAAGGTACCACTCACTCACAGGGGGCAGACCTTTTCCAAAGACCACATCAACCCTCAAAGAGAATGCTCCACTCATCCAGAATGGCACAGGCAGCCTTCCTCGCAACCTGGCAGCCACACTGCAGGACATCGAGACCAAGCGCCAACTGGCCCTGCAGCAGAAGGGGCAGCAGGTGATTGAGGAACAGCGGCGGCGATTGGCTGAGCTGAAGCAGAAAGCAGCAGCCGAGGCTCAGTGCCAGTGGGATGCTCTGCACGGGATGGCCCCCTTCCCAGCAGGCCCCTCGGGCTTCCCCCCACTCGTGCACCACTCCATCCTGCATCACCTGCCAGCTGGGCGGGAACGTGGGGAGGAGGGCGAGCACGCCTATGATACACTGAGCCTGGAGAGCTCTGACAGCATGGAGACCAGCATCTCCACAGGAGGCAACTCCGCCTGTTCCCCCGACAACATGTCCAGTGCAAGCGGCCTGGACGTGGGGAAGATCGAGGAGATGGAGAAGATGCTGAAAGAAGCTCATGCAGAGAAAAGCCGACTCATGGAGTCGAGGGAGCGGGAAATGGAGCTGCGGAGGCAGGCACTGGAGGAGGAGCGGAGAAGGAGGGAGCAGGTGGAACGGAGGCTGCAGAGTGAGAGCTCCAGGAGGCAGCAGCTGGTGGAGAAGGAGGTCAAGATGCGGGAGAAACAGTTTTCTCAGGCACGACCTCTGACCCGCTACCTGCCAAACCGGAAGGAGGACTTTGACTTGAAGACCCACATCGAGTCGTCAGGACATGGCGTCGATACCTGCCTGCACGTGGTGCTCAGCAGCAAGGTCTGCCGTGGCTACTTGGTCAAGATGGGCGGCAAGATTAAATCGTGGAAGAAGCGCTGGTTTGTCTTTGACCGGCTCAAGCGCACCCTTTCCTATTATGTGGACAAGCATGAGACAAAACTGAAGGGGGTCATCTATTTCCAGGCCATTGAGGAGGTATACTATGACCACCTGCGCAGTGCAGCCAAGAGCCCAAACCCAGCCCTCACCTTCTGTGTGAAGACCCATGACCGGCTGTACTACATGGTAGCCCCCTCTGCAGAGGCCATGCGCATCTGGATGGATGTCATTGTCACCGGGGCTGAAGGCTACACTCAGTTCATGAACTGACTGGCATGGGCCTTCTGGACCCTCAGGCCAGCCCCAGGACCCATGCCTGACGATGGCTGCTCTCTTTGGCCCTGGAGACAGAGTCACACCCTGGACTCCAGGCCTCACTGGGGCACTCCCAGAGGACCTGGGAGGGCAGAGTGTGCCTGGGGCTTTTGTACAAGACTTTGTAATGTTGTCTAAGGAGCTCATCCTGGGAGTTTCTGAGCTTGGCCCTCTAAAGAACCAGCCAGGAGATAAAAGGTAGGATGGGGCTTTACTGCCTCCTGGGAGCCCAGAACTTGCAATAACTCTTTAGGGTCCTGCCCTCCCTAGCCTGTATTCTCTTTTGTAAAGAACAAATTATGGTACCTGAATCTGCCAAAGATCCCCTCTTGCCTCAGCCCCCTTTGCAGGGGACTTGAGGGATGAGCAGAGCCACATCCAGAGTGGGGTAATAGCTCAGGCAGTATACTTCTCAAACCCTGCTCTACCCAATTATTCTTCTGCAATTATATTTTTTATTACTTTGCTCAAGGGCCAGAGACCTCAAGTGTCATCCTTGAGGTCTCAGTCCCAACCCTTTTTGCAGACCCATTATCATGGTCACCATAGTAACTGCTTCATTGCCATGGTTACATACTAATTGCTGTGGCTCCATGGCTCAGCCCACTGCTTAAGCTGTGGGCCCATCTGAGGGTATGTGCCATCATCTCTCCAGCCCAAGACCTTGGGTATCTTATGCTGGGGGGAAGGGACTGATCACCTCCCTGCCTCCAGCCTGTGTCTCCAGGCTCTGATACACAGCCTGCTGCCCCAAACCCCCTGCCCTGGGCCAGCCCTCTCCCTTCCACTCGTGCCTTGCTTAGAGCCAGAAGGGATGAAGCTGGGGCTTCTAGATCCAGAGGAGGAGCAATGCGAATGGGAGATAAAGCTATAATGGCTGTCCTCAAGATTTCTGGGGCTGAGTTTCTGACAGGGACAGAGGGCTGCTTCCTTGGGAATGTGAGCAGGAGAGGGAACAGCAGAGAGGGAGGAGTCTGAGGTCCAGCTATGCTCCCTTCGGCCTCAGAAGGGCAATGAAAATGAAGAGCAAAGGTCCAGGCCTCCAGCTGTCCAGCCTCAGCCCTTCAAGCCTTAACATTAGCCCACCTCCCTGTCCCCTTTTCCAGCACTGGGACGTGATAGCTGGGCCCAGCTGAGTGATTTTCAGTATTTGTAAGCATCTCAGCAGAACAATAAAGCATTTGGAGTATG