Transcript asmbl_27825

Sequence
Transcript Sequence for observation asmbl_27825 of TGE0004696:
TGCACGAGCCACACCGTCTTCGGGCCGATCCGTGGTGGACGTTTTCGGAGTAGGCGAGCCGCAGCCTGTGCGCCCCCTCACCGTCTCCTGTGAAACCCTGAGCCGGCTGTGTAGCTTTCTCCCTTTGTCTCAACCATGTCCACCAACGAGAATGCTAATTCACCAGCTGCCCGCCTCAACAGATTCAAGAACAAGGGGAAAGACAGTACAGAAATGAGGCGGCGCCGAATAGAAGTTAATGTGGAACTGAGGAAAGCTAAGAAGGATGACCAGATGCTGAAAAGGAGAAATGTAAGCTCGTTTCCTGATGATGCTACTTCTCCACTGCAGGAAAACCGCAACAACCAGGGCACTGTAAATTGGTCTGTTGATGACATTGTCAAAGGCATAAACAGCAACAATTTGGAAAACCAACTCCAAGCTACTCAAGCTGCTAGGAAACTGCTTTCTAGGGAAAAACAGCCACCCATAGACAACATAATCCGGGCTGGTTTGATTCCAAAATTTGTGTCCTTCTTGGGCAGAACTGATTGTAGTCCCATTCAGTTTGAATCTGCTTGGGCCCTCACTAACATTGCTTCTGGAACATCAGAACAGACCAAGGCTGTAGTTGACGGAGGTGCTATCCCAGCATTCATTTCTCTTTTGGCATCGCCCCATGCTCACATCAGTGAACAAGCCGTATGGGCTCTAGGAAACATTGCAGGTGATGGTTCAGTTTTCCGAGACTTGGTTATCAAGTATGGTGCAGTGGACCCACTGTTGGCTCTTCTTGCAGTTCCTGATATGTCATCTTTAGCATGTGGTTACTTACGTAATCTTACCTGGACGCTTTCAAACCTTTGTCGCAATAAGAATCCTGCACCCCCCTTAGATGCTGTTGAGCAAATTCTTCCTACTTTAGTTCGCCTCTTGCATCACGATGATCCAGAGGTATTAGCAGATAGCTGCTGGGCCATTTCCTACCTTACTGATGGTCCAAATGAACGGATTGAAATGGTCGTGAAAACAGGAGTTGTGCCCCAACTTGTGAAACTCCTAGGGGCTACTGAATTGCCAATTGTGACTCCTGCGCTAAGAGCCATAGGAAATATTGTCACTGGGACAGATGAACAGACTCAGGTTGTTATAGATGCGGGAGCACTTGCCATCTTTCCAAGCCTGCTAACGAACTCCAAAACTAATATTCAGAAGGAAGCTACATGGACAATGTCTAACATCACAGCTGGCCGCCAGGACCAGATACAGCAAGTCGTGAATCATGGATTAGTCCCATTCCTCATTGGCGTTCTCTCTAAGGCAGACTTTAAGACACAAAAGGAAGCTGTATGGGCTGTGACCAACTATACAAGTGGTGGAACGGTTGAACAGATTGTATACCTCGTTCGTTGTGGCATAATAGAACCACTGATGAACCTCTTAACTGCGAAAGATACCAAAATTATTCTGGTTATTCTGGATGCCATTTCAAATATTTTTCAGGCTGCTGAGAAACTAGGTGAAACTGAGAAACTTAGTATAATGATTGAAGAATGTGGAGGTTTGGACAAAATTGAAGCTCTACAAAACCATGAAAATGAGTCTGTGTACAAAGCTTCATTGAACTTGATTGAGAAGTATTTCTCTGTAGAGGAAGAGGAAGATCAAAATGTTGTACCAGAAACTACCTCTGAAGGCTATACATTCCAAGTCCAGGATGGCACTCCTGGGACCTTTAACTTCTAGATTGTACAGCTGGGGCATAAAGTTGTTTGTTGTGCACTGTTTGGTATAAGTTTGTCTTACTGTTTCTCTACTAAGAATTCTTTTTAAATGTGGTTTGTTATTGTAGCACTTTTTACAACAAAACTATACTTGAACAGTTCCAAACTGTACATACTGTACAAAGCGTCTCTCAATGGGTTTCTTATTTCTATGTGGAATTT