Transcript asmbl_27824

Sequence
Transcript Sequence for observation asmbl_27824 of TGE0008917:
TGCACGAGCCACACCGTCTTCGGGCCGATCCGTGGTGGACGTTTTCGGAGTAGGCGAGCCGCAGCCTGTGCGCCCCCTCACCGTCTCCTGTGAAACCCTGAGCCGGCTGTGTAGCTTTCTCCCTTTGTCTCAACCATGTCCACCAACGAGAATGCTAATTCACCAGCTGCCCGCCTCAACAGATTCAAGAACAAGGGGAAAGACAGTACAGAAATGAGGCGGCGCCGAATAGAAGTTAATGTGGAACTGAGGAAAGCTAAGAAGGATGACCAGATGCTGAAAAGGAGAAATGTAAGCTCGTTTCCTGATGATGCTACTTCTCCACTGCAGGAAAACCGCAACAACCAGGGCACTGTAAATTGGTCTGTTGATGACATTGTCAAAGGCATAAACAGCAACAATTTGGAAAACCAACTCCAAGCTACTCAAGCTGCTAGGAAACTGCTTTCTAGGGAAAAACAGCCACCCATAGACAACATAATCCGGGCTGGTTTGATTCCAAAATTTGTGTCCTTCTTGGGCAGAACTGATTGTAGTCCCATTCAGTTTGAATCTGCTTGGGCCCTCACTAACATTGCTTCTGGAACATCAGAACAGACCAAGGCTGTAGTTGACGGAGGTGCTATCCCAGCATTCATTTCTCTTTTGGCATCGCCCCATGCTCACATCAGTGAACAAGCCGTATGGGCTCTAGGAAACATTGCAGGTGATGGTTCAGTTTTCCGAGACTTGGTTATCAAGTATGGTGCAGTGGACCCACTGTTGGCTCTTCTTGCAGTTCCTGATATGTCATCTTTAGCATGTGGTTACTTACGTAATCTTACCTGGACGCTTTCAAACCTTTGTCGCAATAAGAATCCTGCACCCCCCTTAGATGCTGTTGAGCAAATTCTTCCTACTTTAGTTCGCCTCTTGCATCACGATGATCCAGAGGTATTAGCAGATAGCTGCTGGGCCATTTCCTACCTTACTGATGGTCCAAATGAACGGATTGAAATGGTCGTGAAAACAGGAGTTGTGCCCCAACTTGTGAAACTCCTAGGGGCTACTGAATTGCCAATTGTGACTCCTGCGCTAAGAGCCATAGGAAATATTGTCACTGGGACAGATGAACAGACTCAGGTTGTTATAGATGCGGGAGCACTTGCCATCTTTCCAAGCCTGCTAACGAACTCCAAAACTAATATTCAGAAGGAAGCTACATGGACAATGTCTAACATCACAGCTGGCCGCCAGGACCAGATACAGCAAGTCGTGAATCATGGATTAGTCCCATTCCTCATTGGCGTTCTCTCTAAGGCAGACTTTAAGACACAAAAGGAAGCTGTATGGGCTGTGACCAACTATACAAGTGGTGGAACGGTTGAACAGATTGTATACCTCGTTCGTTGTGGCATAATAGAACCACTGATGAACCTCTTAACTGCGAAAGATACCAAAATTATTCTGGTTATTCTGGATGCCATTTCAAATATTTTTCAGGTGAATCTTAACAAGGTGGAATTTATTTGAATTTGGGCTTGATAATT