Transcript asmbl_27768

Sequence
Transcript Sequence for observation asmbl_27768 of TGE0003178:
GGAGCAGAGCGGTTTGGTCGTTCGTTGGAGCAACTTCTTTGTTTTGGTTGGTGACTGCGGCTCTTCGTTGGGCAGTGGGAGCGGTGCGGCGGTGGGAGAGGCGGCCTAGGGCTTCAGCGTTAGGTGAAAGAAAATGGCCCGAACCAAGCAGACTGCTCGTAAATCCACGGGTGGGAAAGCGCCCCGCAAACAGCTGGCCACTAAGGCTGCCAGGAAAAGCGCTCCCTCTACCGGCGGGGTGAAAAAACCTCATCGCTACAGGCCCGGGACCGTTGCGCTTCGAGAAATCCGTCGTTACCAGAAATCGACCGAGCTTCTGATCCGGAAGCTGCCTTTCCAGAGGTTGGTGAGGGAGATCGCCCAGGATTTCAAAACCGACCTGAGGTTCCAGAGTGCTGCCATCGGCGCTCTTCAGGAGGCTAGTGAAGCGTACCTGGTGGGTTTATTTGAAGATACTAATCTGTGTGCCATCCACGCTAAGAGAGTCACCATCATGCCCAAAGATATCCAGTTGGCTCGCCGGATACGGGGGGAGAGAGCTTAAGTGAAGGCAGTTTTTATGGTGTTTTGTAGTAAATTCTGTAAAATACTTTGGTTTAATTTGTGACTTTTTTTGTAAGAAATTGTTTATAATATGTTGCATTTGTACTTAAGTCATTCCATCTTTCACTCAGGATGAATGCGAAAAGTGACTGTTCACAGACCTCAGTGATGTGAGCACTGTTGCTCAGGAGTGACAAGTTGCTAATATGCAGAAGGGATGGGTGATATTTCTTGCTTCTCATGATGCATGTTTCTGTATGTTAATGACTTGTTGGGTAGCTATTAAGGTACTAGAATCGATAAATGTGTACAGGGTCCTTTTGCAATAAAACTGGTTATGACTTGATCCAAGTGTTTAACAATTGGGGCTGTTAAGTCTGACCATGCATCACTGTGATAGAATGTGGGCTTTTTCAAGGGTGAAGATACAAGTCTTAACCACAGTGTAACTTACAGTTTCCTTAAAAAAAGTAAACCTGGCAGCTATAGAATACACTATGTGCATTTATAATAGCTATTTTATATATTGTAGTGTCAACATTTTTAAATTAAATGTTTTACATTCACATGTGGTGGGGAGTCTTGTCATTAAGGTGTGTGTAATTTTAGAGTCCAGTTGGTTTTCTCCTAACTAGAGTGCACTTGTTTTCATAGTAGTAAAATGCTTTGCGCATCATACCTTGCATAAGTCCTCATTCTACCACATGTTAACTAACTCTAGCTGATAATGCAAACACTAACGGGGAATTTTATTTATAAGGGCTCTAGAATATAATACAAGTTATTCACACCAGCATCATCTGTTACTAATCTGAACTAGTTAGTGCAGCTTTTCTTTGTGTTGTGGTTGGTCTCATAACTAGGTTGAGTTTTTCTCTAAGTAGAGGAAACAATACGGAAATTCTTTTCCTTGTGGAGTTTGTATTATAAGGCTTAGAGTAAACTTGTGGTGGGGGAGGGGCACACAGCTCCAGCTTTTCGAACCTCAGCCAGTTAAGATGGCGTCTAGTGAGGTTACATCTGGTATATGGTTCTGGGGAAATCACTTTAGAGATGGTCTTCCAAGTGGTTTTTAAATTTATCCTTCTATTGAAGTTTTTAGGTCAATTATGTATGTTGACTAAATTTACAAATAAACTTGTTTATCCAACTAAGTGTCAAAAACCTAAATTGAATGTACAAACCCACCCATTATCTAGGTCCTTTGTATCTTAAAGTTTGAGTTTAGCTTTTTTAGGTTTTGCTTGGTAGATGAACCTTTTATTTACAAAAATAGTCATAGAAAGCATGTAAAAGTCCCTCTGCTCTGAAAAATGCCATGATTGCTATTTTTTGCAGTGCGGGCTTAAGACGTATTAATATGCTTCCCTTTGCCCCCATGTTGTCAAGGTATAAAAATTTGTCTATTCAAGGTATAACAGGTCAAGGAAAGTAAATTTCTTTAAAATTCGAGGGCTCAAATTTGGTATCTGTTCCAAGAACCTTTTCTGGCAGTATGTAGATCTCTACGTAGCAAATTATTTTAACAGAAGCGCAGAGGTAGAGAATTCATTGGTCTAAGCCACCTTTTCAGTATAAAAACTAGTTTTCTTGACCAATGATGGGCAGCAGTAAAGCTCAGTATATGTCAGCTGGATGTGGGCACAAGAGCCACCAATCATTAGGAGGTGTTCGGTATATTTAAAGTTAGCTGTAGGAACACATTTTTGCCCTAAAGGCTTTTTTAATAAGTTAGCATTAGTTTCAACTTTAAAGGGTTTGTGAAGAAGCTAGCTAGAGTAGCCTTGGGAGTCCTGGTTAAACAGCCTTAGGGGGGATATCAAAGGCGGAGTCCAATACAATACAAAATACAATGAATGGTTTTGTAAAAGGTCCATTATAACCAGTGCTTGGAACAATGACTGACTGAGAACTTATGTTGTTACTTCCGAAGGAAGTTGAAGTCCTAGACATTGGGATATGCTGTGCTCTGGAGTGTGGCAGTGTTTGAACACAAGTAGAAGCAGCTATGAGTTAGCTTGAGTTTCTACCTGTGGTAACAAGCGGGTAACGCTTGAACTTTACGCAGTCTGTGTCTTGATGTAGAAAGTTCTTGAATTTTATTGGGTGACTTGGAATTTGCTGCTTAAATAGTGTAACACTTCCATACTTTACTTGAGCACACATCACAGAAGGCAAAAATATTTTTTGGTTCTAGGAAGGTACCCACACAGGAGATAATCTGGGTATAGGTGATGGAACAGAGTCTGTAAGGAGAAAAGCAAAAATTGGAGCTGATGAAAGGTATCCTGTGCCCTTGATGGATGAGACAAAAATAAAGTTTTTGAAGTTGCAGACTTTC