Transcript asmbl_27738

Sequence
Transcript Sequence for observation asmbl_27738 of TGE0029866:
CTCCTGGGACCCGGCCGGCGCAGAAGCTGCGGATACCCGTCGTCTGGAACTCCGATGGCGGCCACCGTGAACCAGGACCTGCGCAGGGAGCGGGCCGCCGCCAGCTTCAACCCGGATCTGCTCACGCACATTCTGGACGGCGGCGCGGAAAACACCCGGCGCCGCCGCGAGATCGAGAACCTGATTCTCAGAGACCCAGACTTCTTCCAGCATGAAGACTTGAACTTCCTCACTCGCAGCGAGCGTTACGAGTTGGCTATAAAGAAGAGTGCCACCATGGTGAAAAAGATAAGAGACTTTGGCATCTCAGACCCCAATGAAATCATGTGGTTTAAAAACATTCTGTACCGAGTCGGGCCTTCGCCTCTGGATCTTCACTTAGGCATGTTCCTACCCACCTTACTTCACCAGGCCACTGCGGAGCAGCAGGAGCGCTTCTTCATGCCCGCCTGGAGCTTGGAGATCATTGGCACTTATGCACAGACAGAGATGGGTCATGGAACTCATCTTCGAGGCTTGGAAACCACAGCCACTTACGACCCCGAAACCCAGGAGTTCGTTCTCAATAGTCCTACCGTGACCTCCATCAAGTGGTGGCCTGGTGGGCTTGGAAAGACTTCAAATTATGCGATAGTGCTTGCCCAGCTCTACACTAAGGGGAAGTGCTATGGATTACACGCCTTCATTGTACCCATTCGTGAGATGGGAACCCACAAGCCTTTGCCAGGTATTACCGTTGGTGACATTGGCCCCAAATTTGGCTATGATGAGGTGGATAATGGTTACCTGAAGATGGACAGTTACCGTATTCCCAGAGAAAACATGCTGATGAAGTACGCCCAGGTACACTTAGACAGAAAACAGGAGCAGAGGTGTCAAATGCAGAGCTTGCAGTGGCTTTTGATAA