Transcript asmbl_27737

Sequence
Transcript Sequence for observation asmbl_27737 of TGE0029865:
CTCCTGGGACCCGGCCGGCGCAGAAGCTGCGGATACCCGTCGTCTGGAACTCCGATGGCGGCCACCGTGAACCAGGACCTGCGCAGGGAGCGGGCCGCCGCCAGCTTCAACCCGGATCTGCTCACGCACATTCTGGACGGCGGCGCGGAAAACACCCGGCGCCGCCGCGAGATCGAGAACCTGATTCTCAGAGACCCAGACTTCTTCCAGCATGAAGACTTGAACTTCCTCACTCGCAGCGAGCGTTACGAGTTGGCTATAAAGAAGAGTGCCACCATGGTGAAAAAGATAAGAGACTTTGGCATCTCAGACCCCAATGAAATCATGTGGTTTAAAAACATTCTGTACCGAGTCGGGCCTTCGCCTCTGGATCTTCACTTAGGCATGTTCCTACCCACCTTACTTCACCAGGCCACTGCGGAGCAGCAGGAGCGCTTCTTCATGCCCGCCTGGAGCTTGGAGATCATTGGCACTTATGCACAGACAGAGATGGGTCATGGTACGGTGCGTTCAGTCTACCTTCTGGGTTGAGCGGGGCTCTGTGAGCTTGGCCTGTGTGAAGTGC