Transcript asmbl_27734

Sequence
Transcript Sequence for observation asmbl_27734 of TGE0004684:
GGCGGCAGCGGCGGCGGCGGGGGCAGCGGTGGCGGCGGACGCGGTGCCGGAGGAGAGGAGAATAAGGAAAACGAACGGCCATCCGCCGGATCGAAGGCAAACAAAGAATTCGGGGATAGCCTGAGTTTGGAGATTCTTCAGATTATTAAGGAATCCCAGCAGCAGCATGGCTTACGGCATGGAGATTTTCAGAGGTACAGGGGCTACTGTTCCCGCAGACAGAGACGGCTCCGGAAAACGCTTAACTTTAAGATGGGGAACAGACACAAATTCACAGGGAAAAAAGTAACCGAAGATCTTCTGACCGATAACAGATATTTGCTTCTGGTTCTGATGGATGCTGAAAGAGCCTGGAGCTATGCCATGCAGCTCAAACAGGAAGCCAACACTGAACCCCGAAAACGGTTCCACCTGTTGTCTCGCCTGCGGAAAGCTGTGAAGCATGCCGAGGAATTGGAACGCTTATGCGAGAGCAATCGCGTGGACGCCAAGACCAAGCTAGAGGCTCAGGCTTACACAGCTTACAAAAAAAAAAGAACATCAAGAGTGGAAAGCTGCCATTGAGGCTTTTAATAAATGCAAAACGATCTACGAGAAGCTCGCCAGTGCTTTTACAGAAGAGCAGGCCGTGCTGTACAGCCAGCGTGTGGAGGAGATCTCGCCCAACATCCGCTACTGCGCGTATAACATTGGGGACCAGTCAGCCATCAATGAACTCATGCAGATGAGATTGAGGTCTGGGGGCACCGAGGGTCTCCTGGCTGAAAAATTGGAGGCATTGATCACTCAGACTCGAGCCAAACAGGCAGCGACCATGAGCGAAGTGGAGTGGAGAGGGAGAGCGGTCCCGGTGAAGATCGACAGAGTGCGGATCTTTTTGTTGGGGTTGGCCGATAACGAAGCAGCCATTGCCCAGGCTGAGAGCGAAGAAACCAAGGAACGTCTGTTTGAGTCTGTGCTCAGCGAGTGTCGGGACGCCATCCAGGCCGTGCGGGAGGAGCTCAAGCCCGATCAGAAGCAGAGAGATTACACCCTCGAGGGAGAGTCGGGGAAGGTGTCTAATCTTCAGTACCTGCACAGCTACCTGACCTACATCAAGCTGTCAACGGCGATCAGGCGGAACGAGAACATGGCCAAAGGTCTGCAGAGGGCCCTTCTGCAGCAGCAGCCGGAAGACGACAGCAAACGCTCCCCCCGGCCGCAGGACCTCATCCGGCTCTACGACATCATCCTGCAGAATCTGGTGGAATTGCTCCAGCTTCCTGGCTTAGAGGAGGACAGAGCCTTCCAGAAAGAGATAGGCCTCAAGACCCTGGTGTTCAAGGCTTACAGGTGTTTTTTCATTGCTCAGTCCTACGTGTTGGTGAAGAAGTGGAGCGAAGCCCTCGTCCTGTATGACAGAGTCCTAAAATATGCAAATGAAGTGAATTCTGATGCTGGGGCCTTCAAGAATAGCCTGAAAGACCTGCCTGACGTGCAAGAGCTTATCACGCAAGTGAGGTCAGAAAAGTGCTCTCTGCAGGCGGCGGCGATCCTGGATGCAAGTGACTCCCACCAAACAGAGACTTCCTCTCAAGTCAAGGAGAATAAGCCCCTGGTTGAGCGGTTTGAGACCTTCTGCCTGGACCCTTCCCTCGTCACTAAGCAGGCCAACCTCGTGCACTTCCCTCCGGGATTCCAGCCCATCCCTTGCAAGCCTTTGTTCTTTGACCTGGCGCTCAACCACGTGGCTTTCCCACCCCTCGAGGACAAGTTGGAGCAGAAGACCAAGAGTGGGCTCACCGGGTACATCAAGGGCATCTTTGGATTCAGGAGCTAACCACTCTTTTCCTTGGGGGCAGGGGGTAATTCTGACTCGGTCTGTATTGTGAGAAAACTCTAGCAAGTCTGTGATATTAAATCCAGGTCTGCGTTGGCCCAGGGCGGGAGTGTAACATCCTCAGCCCTGCGTTCCTATGTCTGTGTGTGTGCGCTCATGTTCTTAACCGGTGTGCCAGGAGGGCACCCTGTTGTCTTCTGGTGGATGTGTGCGGGGTCCCTCTGTCCATACCTCCCGGAGGAGGGCCGCTGCCATCTGGGCCCGTGCGAGCTGTGATTGTTTACCTCTGGTCCGTAACGTGTTCGGGAGGAGGTCCACTCCAGGCACCGCGAGCGCTCGGAAAGCTTTGCTGCGTTTCTTCAGTGCTGTGGACTTAAAACACACTCCTCCTCGCTGTGAGCATCCAGGACCCTTTGGAAAGTTTGTTCGTGACTAGGAAACACTGGCAACGTCCCCCCAGAACGACAGTCAGCCTCCCCCCTTCACTGCCAAGTGAAAGTTCAGAAGTTTCAGAACAAGCAAAGAGCTCTATTTTTAGAAGAAATATGTTATACTCAGAATTGATGAAAACAAATCTTATATTAAAAGGCAAAGATGCTGGA