Transcript asmbl_27724

Sequence
Transcript Sequence for observation asmbl_27724 of TGE0004678:
CACTGGCCCTCGGGAGGCTGCGGCACGGCTCGCCCTGAGCTCCGGGTCCCACAGAGCGCGTCGCGGCCTTTCGTACGAGGAGGCTGGGCATCTTGGACCGCTCCCCTCCTCTGCCGGGTTCCTTGGCATCTTCTCCGGCCGGACCCCCGGGCCTCGCGGCCCCCTCAGTCGGCACCGTTCCCGGCTGCAGCCCCGCGCGGGCCGGCTGTAACCGCGCCGCGGGCCGGACGATGCCCAGGAAGCTGCTGCTGCTGCCCCCGCGCTCCGTGCCCTCGGCTTTCCGCGCCCCGCGAGCCAGCTCCTCCGCAAGCGCGGCCATGAACGCCGCCCGCACCGGCTACCGAGTCTTCTCGGCCAACTCCACGGCCGCCTGCACCGAGCTGGCCAAGCGCATCACCGAGCGTCTTGGTGCTGAATTGGGGAAGTCTGTGGTATATCAAGAGACCAATGGAGAAACAAGAGTTGAAATAAAAGAATCTGTTCGTGGCCAAGATATTTTCATTATACAGACAATACCCAGAGATGTGAATACAGCTGTGATGGAGTTGCTGATCATGGCTTATGCGCTGAAGACGGCCTGTGCCAGGAATATTATCGGAGTCATCCCTTATTTCCCCTACAGCAAGCAAAGCAAGATGAGGAAGAGGGGTTCCATCGTGTGCAAGCTACTAGCATCCATGCTGGCGAAAGCAGGTTTAACTCACATTATCACTATGGACCTTCATCAAAAGGAAATACAAGGCTTTTTCAGCTTTCCCGTGGACAACCTTAGAGCCTCACCTTTCCTGCTTCAGTATATCCAGGAAGAAATTCCAAATTACAGAAATGCAGTCATCGTAGCGAAGTCTCCTGATGCTGCAAAAAGGGCCCAGTCATACGCTGAGAGGCTCCGTCTGGGTCTAGCCGTGATCCACGGAGAAGCACAGTGCACAGAGCTGGATATGGACGACGGTCGTCACTCACCTCCGATGGTCAGAAATGCCACCGTCCACCCGGGCCTGGAATTGCCGTTGATGATGGCCAAAGAGAAGCCACCGATAACTGTCGTCGGAGACGTCGGAGGGAGCATCGCGATCATAGTGGATGACATCATCGACGACGTGGAAAGTTTTGTCGCTGCGGCAGAGATCCTGAAGGAGAGGGGCGCTTACAAGATCTACGTCATGGCCACTCACGGCATCCTGTCCGCAGAGGCCCCCCGCCTCATCGAGGAGTCCTCCATCGATGAGGTGGTGGTGACGAATACTGTCCCTCACGAGGTGCAGAAGCTGCAGTGTCCCAAGATAAAGACTGTGGACATCAGCCTGATTCTCTCTGAGGCCATTCGGAGAATCCACAACGGAGAGTCCATGGCGTACCTCTTCCGGAACATCACTGTGGACGACTAGCTTTCTCTGGAACTCCTGAGACGCGTGGGAGGCGGCAGCAGTGTGACGTCCGCAGCGTTTCCTTGCAGGGGACTCGGGTGGTCTCGTGCCGTTCGCTTTGTAGGAGGCTTTAAGATAGTCGAGGGGGAGACACAGCTAATGGGTAAAGGGCCTTAAACGTCTGCCCTCACCATCCCGTCCCTCAAACAGAAGTCACATTTTCCTGAAAAGAACCTGAACATCTTCTGACACTGCAAAGGCGTTAGAGGCAGAGACAGTGCTAACTCTGGTGTCCGTTCAGCTGTTTCGGCCGCAGGGAGACGTGTGTTCACGTTGAACTTGGGCGGGCAGCTGGGCGCCCCGGCTCTGTGCCTGCTGCAGTTGTCCTCTCCCTGGCCAACTGCACGTAAACCTTTTGTAGAGAACCGTGTTTTCCTCTGAGAAGCTGCTGTGCGTACAGCCTCTGAACCATAAAGCATTTAGCGTCATCCCCAGCAAGGCCCTAGATAGAGAATAAGACCCTGTCTCTCGGTGTCTGCATTGCTCTTAAATTACAAATAAAGGAATTTGTTATCTTGCTCGTCTGGTCACTCCATTGCAGAGCCGCCCACTGCCCCGCC