Transcript asmbl_27695

Sequence
Transcript Sequence for observation asmbl_27695 of TGE0004673:
ATTGGCCAGCGCGCGGAGGGTAAAAGTGGGCGCGCGGGAACCGGCGCGAGCTTTCGGAGCTGCGGGTGCGAGCGAGGTTTCTGTCCGGAGAGGTTCCTGGAGGTGCCATGAGCTGCGTCAACCTGCCCACGGTGCTGCCTGGCTCCCCCAGCAAGACCCGGGGGCAGATCCAGGTGATCCTCGGACCCATGTTCTCAGGAAAAAGCACGGAGCTCATGAGACGGCTCCGACGCTTCCAGATTGCCCAGTACAGGTGCTTGATGATCAAATACGCCAAAGACACGCGGTACAGCGACAGCTTCTGCACGCATGACCGAATATTTCGTCGGCTCCTAAAAGGACCGTAAGCCCTGGCTGCTGTGCCTGATGAGGTCACCCTGTCCATCCCGGCCCACCGTTGAACAGAAGCAGAGGAGAACTTTACAGTGGCCCCACTGACATCTGGTCCAGAGGGCCGGTGTCCCCCTCAAAGGCCTTCCCAGGGCGCCAGCTCCTCGATGCCCTGAGCACTCAGGGCAACCTGCGTCACCGGAACACCATGGAGGCGCTGCCGGCCTGCCTGCTCCGCGACGTGGCCCAGGAGGCCCTGGGCGTGACTGTCATAGGCATCGACGAAGGGCAGTTTTTCCCTGACATTGTGGAGTTCAGCGAGGCCATGGCCAACGCCGGGAAGACTGTGATTGTGGCTGCACTGGATGGAACCTTCCAGAGGAAGGCTTTCGGGACCATCCTGAACCTGGTGCCCCTGGCCGAGAGCGTGGTGAAGCTGACGGCCGTGTGCATGGAGTGCTTCCGCGAAGCCGCCTACACCAAGAGGCTGGGCATGGAGAAGGAGGTTGAGGTGATCGGAGGAGCTGACAAATACCACGCTGTGTGCCGCCTCTGCTACTTCCGAAAGGCCTCGGGTCAGCCCGACGGGCTGGACAGCAACGAGGACAAGGAGAACTGGCTGGTGCTGGGAAAGCTGGGGGAGGCCGCGGAGGCCAGGGCGGCCACGGGGGCCCGGAAGCCCCTCGCTGCGCATCAGATCCTGCAGCGCAGCCCCCCCAACTGAGGCCCCAGTGATGCCTTCCCCTCTGCATGCCCGGCGGCCTGTCAGAGGAGGAAGTCCCAGGTGGGTGAGGCTTCCTGGGCACCTGGAACTTTCTGCCATCACAGGGCCCTGCCCTGCTGGCGGTATGCGGCCCATTTCTCCCTCTGCCTGCCCACTGCCTCTCAGTTCCCTTCCCAGCTGCCGATCCGCTCAGGACCACCCCGGGCTGGAGCCGGCCACTGCCCGCACCGCTCCTTCTCCTTTGAGCTGTGGGGCAGGCCACACGCTGCTGTGACGTCAGCCCGGCTGGCTTCTTCCCCCTCTGTGGCTTTCACTGTTGAGTTTCGGTTCTCACTGGGAAGTTCAGGCGGCAGCACCTCTGGCTCAGCGCGGAGCCTCATTCCACACAAAGGATTCTGTCCCTTGGCCTGGGACAGGCTCCCAGCCGGAGGGCGGCTAGACTTGTGCCCTTTCGCTTCCCTGTGGGCTGAAAGCTCTTCCTGCTCTGGTGATGACTTTCTTGAGGCTCACAGCTTCATTCATGTGGGTGACACCTGCTGAGGCTCAGACCCCAGGGGTTTGCTAGTCTTTTATGGGGAACTGGGGGCAAGGTCCCTGATTCTTGTGGTAGAGAGTGAAATGAATACGTGACATTAAAATGCACTAGTTGG