Transcript asmbl_27693

Sequence
Transcript Sequence for observation asmbl_27693 of TGE0029857:
ATTGGCCAGCGCGCGGAGGGTAAAAGTGGGCGCGCGGGAACCGGCGCGAGCTTTCGGAGCTGCGGGTGCGAGCGAGGTTTCTGTCCGGAGAGGTTCCTGGAGGTGCCATGAGCTGCGTCAACCTGCCCACGGTGCTGCCTGGCTCCCCCAGCAAGACCCGGGGGCAGATCCAGGTGATCCTCGGACCCATGTTCTCAGGAAAAAGCACGGAGCTCATGAGACGGCTCCGACGCTTCCAGATTGCCCAGTACAGGTGCTTGATGATCAAATACGCCAAAGACACGCGGTACAGCGACAGCTTCTGCACGCATGACCGGAACACCATGGAGGCGCTGCCGGCCTGCCTGCTCCGCGACGTGGCCCAGGAGGCCCTGGGCGTGACTGTCATAGGCATCGACGAAGGGCAGTTTTTCCCTGACATTGTGGAGTTCAGCGAGGCCATGGCCAACGCCGGGAAGACTGTGATTGTGGCTGCACTGGATGGAACCTTCCAGAGGAAGGCTTTCGGGACCATCCTGAACCTGGTGCCCCTGGCCGAGAGCGTGGTGAAGCTGACGGCCGTGTGCATGGAGTGCTTCCGCGAAGCCGCCTACACCAAGAGGCTGGGCATGGAGAAGGAGGTAGCTGCCACCCAACTTCTCCCAGGGTGGGGGCGGCCTGGAGGTGCTGTGCCCGCTCAGCCCAGGCCCTTCGTGTCCCCCGGGCTAGGTTGAGGTGATCGGAGGAGCTGACAAATACCACGCTGTGTGCCGCCTCTGCTACTTCCGAAAGGCCTCGGGTCAGCCCGACGGGCTGGACAGCAACGAGGACAAGGAGAACTGGCTGGTGCTGGGAAAGCTGGGGGAGGCCGCGGAGGCCAGGGCGGCCACGGGGGCCCGGAAGCCCCTCGCTGCGCATCAGATCCTGCAGCGCAGCCCCCCCAACTGAGGCCCCAGTGATGCCTTCCCCTCTGCATGCCCGGCGGCCTGTCAGAGGAGGAAGTCCCAGGTGGGTGAGGCTTCCTGGGCACCTGGAACTTTCTGCCATCACAGGGCCCTGCCCTGCTGGCGGTATGCGGCCCATTTCTCCCTCTGCCTGCCCACTGCCTCTCAGTTCCCTTCCCAGCTGCCGATCCGCTCAGGACCACCCCGGGCTGGAGCCGGCCACTGCCCGCACCGCTCCTTCTCCTTTGAGCTGTGGGGCAGGCCACACGCTGCTGTGACGTCAGCCCGGCTGGCTTCTTCCCCCTCTGTGGCTTTCACTGTTGAGTTTCGGTTCTCACTGGGAAGTTCAGGCGGCAGCACCTCTGGCTCAGCGCGGAGCCTCATTCCACACAAAGGATTCTGTCCCTTGGCCTGGGACAGGCTCCCAGCCGGAGGGCGGCTAGACTTGTGCCCTTTCGCTTCCCTGTGGGCTGAAAGCTCTTCCTGCTCTGGTGATGACTTTCTTGAGGCTCACAGCTTCATTCATGTGGGTGACACCTGCTGAGGCTCAGACCCCAGGGGTTTGCTAGTCTTTTATGGGGAACTGGGGGCAAGGTCCCTGATTCTTGTGGTAGAGAGTGAAATGAATACGTGACATTAAAATGCACTAGTTGG