Transcript asmbl_27673

Sequence
Transcript Sequence for observation asmbl_27673 of TGE0004671:
CGGCGCCGGGCCCCGCTTCCGCCTTCCGCTGAGGCGCGCGCTTTGCTCTCATCCTGTTCGGGATCATGGCGGCCACGGCCACGATGGCGACCTCTGGCTCGGCGCGGAAGCGTCTGCTCAAAGAGGAAGACATGACCAAAGTGGAATTCGAGACCAGCGAGGAGGTGGACGTGACCCCCACGTTCGACACCATGGGCCTGCGGGAGGACCTGCTACGCGGCATCTACGCCTACGGATTTGAAAAACCGTCGGCAATCCAACAGCGAGCCATCAAGCAGATAATTAAAGGGCGAGATGTCATCGCACAGTCTCAGTCTGGCACAGGCAAAACTGCCACCTTCAGTATTTCCGTCCTCCAGTGTTTGGATATTCAGGTTCGTGAGACCCAGGCTTTGATTTTGGCCCCAACGAGAGAGCTGGCTGTGCAGATCCAGAAGGGCCTGCTCGCTCTGGGTGACTACATGAACGTCCAGTGTCACGCCTGCATCGGGGGCACCAACGTGGGGGAGGACATCAGGAAGCTGGACTATGGACAGCACGTGGTCGCCGGCACGCCGGGCCGTGTCTTTGATATGATTCGTCGCAGAAGTTTAAGGACACGTGCTATCAAGATGCTGGTTTTGGATGAGGCCGATGAAATGCTGAATAAAGGTTTCAAAGAGCAGATCTACGACGTGTACAGGTACCTGCCCCCGGCCACGCAGGTGGTGCTCATCAGCGCCACGCTGCCCCACGAGATCCTGGAGATGACCAACAAGTTCATGACCGACCCCATCCGCATCCTGGTGAAACGTGACGAGCTGACTCTAGAAGGCATCAAGCAGTTTTTTGTGGCGGTGGAGAGAGAAGAGTGGAAATTTGACACTTTGTGCGACCTCTACGACACGCTGACCATCACACAGGCTGTCATCTTCTGCAACACCAAAAGGAAGGTTGACTGGCTGACAGAGAAGATGAGAGAAGCCAACTTCACCGTGTCGTCGATGCATGGGGACATGCCACAGAAGGAGCGGGAGTCCATCATGAAGGAGTTCCGGTCTGGTGCCAGCCGCGTGCTCATTTCCACCGACGTCTGGGCCCGGGGGCTGGACGTCCCTCAGGTGTCCCTCATCATCAACTATGACCTGCCCAACAACAGAGAGCTGTACATCCACAGGATCGGCCGGTCGGGCCGGTACGGCCGGAAGGGCGTGGCCATCAACTTCGTAAAGAACGATGACATCCGCATCCTGCGGGACATCGAGCAGTACTACTCCACGCAGATCGACGAGATGCCCATGAACGTTGCCGACCTGATCTGAGGCGCCCGCCGGGGTCCCGCAGCCACGGGGGCCGTTCCGGGCCGGTCCTCGTTCCTGGAGTCATGTGGACTCTCCTCACAGAGTCCCCGCAGTTGGAGTCATGTGGATTCTCCTCACAGAGTGCTGGTGGTGGTAGAGGTTCTTCCTTTTCTTACTTATGTGTAAATAGCGCTTTGCTTTATGTGTTTTTCATTAAACGCTTGAAACTCTTCCGTTG