Transcript asmbl_27644

Sequence
Transcript Sequence for observation asmbl_27644 of TGE0004666:
CCTCGCTGTCCGGCGGCGCCAACTGAAGCGCCGCTCCCGCTGCCGACATGCTGCGCCGCGTTCTGCTCTGCCTGGCCCTGGCCGCGCTAGGTCGCGCGGGCGCCGACCCCGACGAGGAGGACCACGTCCTGGTGCTGCACAAGGGCAACTTCGAGGAGGCGCTGGCGGCCCACAAGTACCTGCTGGTGGAGTTCTATGCCCCTTGGTGCGGCCACTGCAAGGCCCTGGCCCCCGAGTATGCCAAAGCGGCTGGAAAACTGAAGGCGGAAGGTTCCGAGATCAGACTGGCCAAGGTAGACGCCACGGAGGAGTCTGACCTGGCCCAGCAGTATGGCGTCCGCGGCTACCCTACGATCAAGTTCTTCAAGAATGGAGACACGGCTTCCCCCAGGGAGTATACAGCTGGCAGAGAAGCCGACGACATTGTGAACTGGCTGAAGAAACGCACGGGCCCCGCTGCCACCACACTGCCCGACGAGGCCGCCACAGAGGCCTTGGTGGAGTCCAGCGAGGTGACGGTCATCGGCTTCTTCAAGGACGTGGAGTCGGACTTTGCCAAGCAGTTCCTGTTGGCAGCGGAGGCCATTGATGACATACCCTTTGGGATCACGTCCAATAGTGACGTGTTCTCCAACTATCAGCTGGACAAGGACGGGGTTGTCCTCTTCAAGAAGTTTGACGAAGGCCGGAACGACTTTGAGGGGGAGGTCACCAAAGAGAAGCTGCTGGCCTTCATCAAGCACAACCAGCTGCCGCTGGTCATCGAGTTCACCGAGCAGACGGCCCCGAAGATTTTTGGAGGGGACATCAAGACTCACATTCTGCTGTTCCTGCCCGAGAGTGCGCCTGACCGCGACGGCAAGCTGAGTGGCTTCAAGAAGGCTGCCGAGCGCTTCAAGGGCAAGATCCTGTTCATCTTCATCGACAGCGACCACGCCGACAACCAGCGCGTGCTCGAGTTCTTCGGCCTGAAGAAGGAGGAGTGTCCGGCCGTGCGCCTGATCACCCTGGAGGAGGAGATGACCAAGTATAAGCCAGAGTCAGCCGGGCTGACGGCAGACGAGATCACGGACTTCTGCCAGCGCTTCCTGGATGGCAAGGTCAAGCCACACCTGATGAGCCAGGAGCTGCCTGAGGACTGGGACAAGCAGCCTGTCAAAGTGCTGGTTGGGACCAACTTTGAAGAGGTGGCTTTCGATGAGAAGAAGAACGTCTTCGTGGAATTCTACGCCCCCTGGTGCGGCCACTGCAAACAGCTGGCTCCCATTTGGGATAAGCTGGGAGAGACGTACAGGAACCACGACAACATTGTCATCGCCAAGATGGACGCGACGGCCAACGAGGTGGAGGCCGTTAAAGTTCACAGCTTCCCCACGCTCAAGTTCTTCCCTGCCAGCGCAGACAAGACGGTCATCGACTACAACGGGGAGCGCACCCTGGAAGGCTTTCGCAAGTTCTTGGAGAGTGGCGGCCAGGACGGGGCAGGGGATGACGATGATCTCGAAGACCTAGAGGAGGCAGAAGAGCCCGACCTGGAGGAAGACGACGATCAGAAAGCTGTGAAGGACGAACTGTGATGTCACAACCAGCCCAGCACCCTGACGCGCCCTCGGAGCTGCAGCCCCTCAGCGAGGCTTGGGAGCCCGGGAGCCCGGGCCCCCGGGGAGGAGGCGCACCAGCCAGAAGTGCGGGGGACTTCCTGAGGCGACACCTCACTGACACGCGTAGGCTTAGACCCGCCTCTCCTTCCGCCTTTCCGTTCCTGGAAAGGACCCTCCCCAGGCCAACGTCGGGGCCCATTTTTTTAATTGATGTACTTTTTCGTACACGGTTTCTTCCAGAACGCGCCCAAAAATGTTTGCGAATCTCACGTGGCAGTGTCTCCTTCCCGTTAGGTTTATACTATCACTTTTAAAAATTTCCATCTGTGGGATTCTTGGACATTTTTGGACATCGGGGTCTCTGCTCACCTTGGTCGGGTCACCCTGGAGACCGATGTGCCCTGTGTGGAAAGGGCCCAAGCCATGCTGGACGGGTCACCCCCCTCACACCCATGTTGCTGTGACCGAGTGTGGCTCCCGCAGCGTGTGGTTAAATGGAGACTTCCGGTCTCTGTCGCAGAGGCCGCCATGACTGGGGGGTGCCGGTGGGGCCAAGACAGGGCCTTCTCCCCGAGCCAGGCTCCTCACCGCGGAGGCCTGAGCCGGCCTGAACCAGGACCCTCCACTTCCAGGCTGGGACACAGCCGCGGGAGCTCGAGCCCGGCCAGCCGTTAGCGGTCCTCAGGTCCCTCCACCACAGCGTGGGGACAACTCATTGGCCAAATAAACTTCCAATTTCAGTG