Transcript asmbl_27642

Sequence
Transcript Sequence for observation asmbl_27642 of TGE0004664:
GGCGTGGGCGGACCCGAGCGGGCTTCATCGACCCCATCCGAGGTCCTGGGGCGTGTGATAGGGAACCATAGCCTCAGTCGTGCCGCTCCTGCTGGACAGCGCTGCTGCAGACTCTTCTGGACCAGGGTCCGGAAGGAGGGTCCTGAGAGCACCAAGAGGCTGCAGCAGGTCCTAGCTCTAGGTCACACACCGTCACAACAGGAAGGAACGTGGGCGGACAGGATTCCCGTGCCCTTGTGAGAAACCTGTGGGACTCAGGCTGGCCCCTTTATCTGAGTTCCAGGAGAGCCTCGCATTTGCACGGCGAGGCAGAACTGACTTGTGTCGTGCATGGAGGCCTTGCTTCCCCGCTGGATCGAGGTGTGGCAGATCCAGCTAGAGGCAGCATGGCCGAGCAGGAGCCCACCGCCGAGCAGTTGGCGCAGATTGCGGCGGACAACGAGGAGGACGAGCACTCGGTGGGCTACCGGCCCCCGGCCCAGAAGAGCATCCAGGAGATCCAGGAGCTGGACAAGGACGACGAGAGTCTGCGCAAGTACAAAGAGGCCCTGCTGGGCCGTGTGGCTGTGGCCGCTGACCCCAATGTCCCCAACGTTGTTGTGACCCGCCTGACCCTGGTGTGCAGCACAGCCCCGGGCCCCCTGGAGCTGGACCTGTCTGGGGACCTGGAGAGCTTCAAGAAGCAGTCGTTTGTGCTGAAAGAGGGTGTGGAGTATCGGATAAAGATCTCTTTCCGGGTGAACCGAGAGATCGTGTCCGGCATGAAGTACATCCAGCACACGTTCCGGAAAGGCGTCAGGATCGACAAGACCGACTACATGGTGGGGAGCTACGGGCCGCGCGCCGAGGAGTACGAGTTCCTGACGCCCGTGGAGGAGGCGCCGAAGGGCATGCTGGCCCGCGGGAGCTACAACATCAAGTCCCGCTTCACAGACGACGACAAGACTGATCACCTGTCCTGGGAGTGGAATCTCACCATCAAGAAGGAGTGGAAGGACTGAGCGTAGGCCTGGAGGCAGGCAGGGTGATGGCGGGGCGCACCCCCCACCCCTCCCCCACCCCCATACCAAAGTGCTGACAGGGCGCCTGCCCACGCTGCGGTCTTTCCCCCTGGTCCGCCTCCCGGCCAGCCCGGCCCCCCTCGACCCTCCCCAGCCTGCAGCCCCCAGCCTCCTGGGTGGTCTCGTGTCACTGCTGCTTCATTCTGTGCTGTGAGGGGAGGACGGCCGTAGCCCAGGCCTCCCCCTCCCCCTCTGTGTCCCTCCACGTTCCCCCACCTGTCCTGACCCCGCCTGAGGCCCTGGCTTTTCCGAGGCAGTGGGGCATTGGATGGGGTCTCGTGGTTTCAGTTGCCCCAACTCCCATCGTCTCCCCCTGCGGGGTGGGGGTGGGGTGCATGATGCAGGGCCTTGTGGGGACCAGCCGTCCCCCAGCTGTCACTCTTCCCTGGTCAGCTTGCCCACCGTTGTCAGTAACCATCTAACCATGATGCCTTAACATGCAGAACGTGTGCGTGGGGCCGTCACTAATCTCTGACCCCTGTGTCTGCATGAGCATGTGGTCTCCCCCAGTCCCTTTCCCAGCTGCAGTCCCGGTCGCCCAGGGAGGTGTAGGATGTGCTGCTGCTGTTCCCCGGCCTGCCAGGGCCTGGCCAGCCCCCTCCCCGTGGCCCTCCCCTAGCCCGGGCTGTGGGGACAGTCCCAGGCGCTTAGGGAAAGCCAAATTGCCAAAACTCAAGTCGCCTCCAGTCTCATCGGGGAGGCTGGGTGTCCTCATGCCTCTGCCTTCTTTGTCCCAGTGGGCAGCACCCAGACCCAGACCCCACAGCCCCGACAGACAGCCCTCGGTGGACAAAGCCAGCAGCCGAGCCTTACTTGTCCCACCTGGGCCCACCGGCCTGGAGTGGCATGCCTGGCCTGTCAGTATTTATTGCCTCCATATGTGCCGTCCTCTGGGCCCGCTGGCCTGCCACCTCTGCCCCCAGGCTCGGTGCCACCATCCCTGGCAGGCCCTCCCCGGACCCAGCCAGGACACCCGTGGGACCAAGCATGCACAGTCGGAGCTGTCCCCTGTGCCACCCCTCCCCTCGCTGGTCAGGCCCGGGCTGGAACACAGGAACCCGTCCCTGCTTCTCCTTTTCAGACCAGGAAATAAACTCCCCCCCAGAGGA