Transcript asmbl_27641

Sequence
Transcript Sequence for observation asmbl_27641 of TGE0004664:
GGCGTGGGCGGACCCGAGCGGGCTTCATCGACCCCATCCGAGGTCCTGGGGCGTGTGATAGGGAACCATAGCCTCAGTCGTGCCGCTCCTGCTGGACAGCGCTGCTGCAGACTCTTCTGGACCAGGGTCCGGAAGGAGGGTCCTGAGAGCACCAAGAGGCTGCAGCAGGTCCTAGCTCTAGGTCACACACCGTCACAACAGGAAGGAACGTGGGCGGACAGGATTCCCGTGCCCTTGTGAGAAACCTGTGGGACTCAGGCTGGCCCCTTTATCTGAGTTCCAGGAGAGCCTCGCATTTGCACGGCGAGGCAGAACTGACTTGTGTCGTGCATGGAGGCCTTGCTTCCCCGCTGGATCGAGGTCCGAGGCGTCCACGGTTGGGGAGCAGCTCCCTGAGCCAGCAGCAGGGACCCCTGGGGCTGGGGACCTGGGTGACTCAGGACAAGCAGCAGAACTCGAGGCGACTCTGAGCTGGGGTTGCTGCGTCTCTCTGGGGGCAGGCTGCAGGTCCCATGGGTCCTCAGACTGTCTCAGCAGGTCCCCAGAGGTAGGCAGGGCAGAGGTGTGGCAGATCCAGCTAGAGGCAGCATGGCCGAGCAGGAGCCCACCGCCGAGCAGTTGGCGCAGATTGCGGCGGACAACGAGGAGGACGAGCACTCGGTGGGCTACCGGCCCCCGGCCCAGAAGAGCATCCAGGAGATCCAGGAGCTGGACAAGGACGACGAGAGTCTGCGCAAGTACAAAGAGGCCCTGCTGGGCCGTGTGGCTGTGGCCGCTGACCCCAATGTCCCCAACGTTGTTGTGACCCGCCTGACCCTGGTGTGCAGCACAGCCCCGGGCCCCCTGGAGCTGGACCTGTCTGGGGACCTGGAGAGCTTCAAGAAGCAGTCGTTTGTGCTGAAAGAGGGTGTGGAGTATCGGATAAAGATCTCTTTCCGGGTGAACCGAGAGATCGTGTCCGGCATGAAGTACATCCAGCACACGTTCCGGAAAGGCGTCAGGATCGACAAGACCGACTACATGGTGGGGAGCTACGGGCCGCGCGCCGAGGAGTACGAGTTCCTGACGCCCGTGGAGGAGGCGCCGAAGGGCATGCTGGCCCGCGGGAGCTACAACATCAAGTCCCGCTTCACAGACGACGACAAGACTGATCACCTGTCCTGGGAGTGGAATCTCACCATCAAGAAGGAGTGGAAGGACTGAGCGTAGGCCTGGAGGCAGGCAGGGTGATGGCGGGGCGCACCCCCCACCCCTCCCCCACCCCCATACCAAAGTGCTGACAGGGCGCCTGCCCACGCTGCGGTCTTTCCCCCTGGTCCGCCTCCCGGCCAGCCCGGCCCCCCTCGACCCTCCCCAGCCTGCAGCCCCCAGCCTCCTGGGTGGTCTCGTGTCACTGCTGCTTCATTCTGTGCTGTGAGGGGAGGACGGCCGTAGCCCAGGCCTCCCCCTCCCCCTCTGTGTCCCTCCACGTTCCCCCACCTGTCCTGACCCCGCCTGAGGCCCTGGCTTTTCCGAGGCAGTGGGGCATTGGATGGGGTCTCGTGGTTTCAGTTGCCCCAACTCCCATCGTCTCCCCCTGCGGGGTGGGGGTGGGGTGCATGATGCAGGGCCTTGTGGGGACCAGCCGTCCCCCAGCTGTCACTCTTCCCTGGTCAGCTTGCCCACCGTTGTCAGTAACCATCTAACCATGATGCCTTAACATGCAGAACGTGTGCGTGGGGCCGTCACTAATCTCTGACCCCTGTGTCTGCATGAGCATGTGGTCTCCCCCAGTCCCTTTCCCAGCTGCAGTCCCGGTCGCCCAGGGAGGTGTAGGATGTGCTGCTGCTGTTCCCCGGCCTGCCAGGGCCTGGCCAGCCCCCTCCCCGTGGCCCTCCCCTAGCCCGGGCTGTGGGGACAGTCCCAGGCGCTTAGGGAAAGCCAAATTGCCAAAACTCAAGTCGCCTCCAGTCTCATCGGGGAGGCTGGGTGTCCTCATGCCTCTGCCTTCTTTGTCCCAGTGGGCAGCACCCAGACCCAGACCCCACAGCCCCGACAGACAGCCCTCGGTGGACAAAGCCAGCAGCCGAGCCTTACTTGTCCCACCTGGGCCCACCGGCCTGGAGTGGCATGCCTGGCCTGTCAGTATTTATTGCCTCCATATGTGCCGTCCTCTGGGCCCGCTGGCCTGCCACCTCTGCCCCCAGGCTCGGTGCCACCATCCCTGGCAGGCCCTCCCCGGACCCAGCCAGGACACCCGTGGGACCAAGCATGCACAGTCGGAGCTGTCCCCTGTGCCACCCCTCCCCTCGCTGGTCAGGCCCGGGCTGGAACACAGGAACCCGTCCCTGCTTCTCCTTTTCAGACCAGGAAATAAACTCCCCCCCAGAGGA