Transcript asmbl_27515

Sequence
Transcript Sequence for observation asmbl_27515 of TGE0000808:
CTTCTTGTCGCTTGCTGTGAGTGTCTCTGTGGCGGGATGCAGGGAATAGGGGGGTAATCCGAGGTACCGGCGCGCGCCCTCCGCCCTCATAGCCATGCCTCGCAAAATTGAGGAGATCAAGGACTTCCTGCTCACGGCCAGACGAAAAGATGCCAAATCTGTCAAGATCAAGAAAAATAAGGATAATGTGAAGTTTAAAGTTCGGTGCAGCAGATACCTTTACACCTTGGTCATCACAGACAAAGAGAAGGCCGAGAAACTGAAGCAGTCCCTGCCCCCCGGTTTGGCAGTGAAGGAGCTGAAATGAACCAGACATGCTGATCTGAACTGCATTAAAATTTTTAAAAATCTTAAAA