Transcript asmbl_23832

Sequence
Transcript Sequence for observation asmbl_23832 of TGE0004349:
GGGGCACGTTGGAATCATGTGTGGGTCGGCACCGAGACTGGGATCCTGAAAGGGGTGAATCTTCAGCGCAAACAGGCCGCGAATTTCACGGCGGCGGGACAGCCGCGGCGGGAGGAGGCGGTGAGCGCCCTGTGCTGGGGCGCGGGTGGTGAGACACAGATCCTTGTGGGCTGTGCTGACTCGACCGTGAGGCACTTCAGCACCGAGGATGGCAGATTCCAGGGCCAGAGGCACTGCCCCGGCGGGGAGGGCACTTTCCGAGGCCTCGCCCAGGTCGATGGCACCCTTATCACATGTGTGGATTCTGGGATTCTCCGAGTCTGGCGTGACAATGACAAGGAGATATCAGCTGATCCACTCCTGGAACTGAGGGTAGGCCCTGGGGTGTGTAGGATGCGCCAAAACCCAGCGCGCCCTCATGTAGTTGCCACAGGTGGGAAGGAGAATGCTTTGAAGGTGTGGGACCTCCAGGGGTCTGAGGAGCCTGTGTTCAGAGCCAAGAATGTACGGAATGACTGGCTTGACCTGCGAGTTCCCATCTGGGACCAGGACATACAGTTCCTCCCTGAGTCGCAGAAGCTTGTCACCTGTACAGGGTACCACCAGGTCCGTGTCTATGATCCAGCCTCTCCTCAGCGCCGGCCGGTCCTAGAGGCCACCTATGGAGAGTATCCACTGACAGCCATGACTCTCACTCCTGGGGGCAATTCGGTGATCGTGGGGAACACTCACGGGCAGCTGGCAGAAATCGACCTTCGGCAAGGACGTCTACTGGGCTGTCTGAAGGGGCTGGCAGGCAGCGTCCGTGGGTTGCAGTGCCACCCTTCAAAGCCCCTACTAGCCTCCTGTGGCTTGGACAGAATCTTGAGGGTACACAGGATCCGGAATCCACGGGGCCTGGAGCATAAGGTTTATCTTAAGTCTCAGCTGAACTGCCTTCTCCTGTCAGGCAGGGACAACTGGGAGGATGAGCCCCAAGAGCCTCAAGAGTCCATCAAGGTGCCCCCAGAAGACACAGAGGCAGATGAACTTTGGGCTTCTTTGGAGGCAGCTGCCAAGCGGAAGCTCCCTGATTCGGAGCTGACCCCAGGGTCTCGGCCAACCAGACGGAGAAAGAAGCGGCCTGGCTCCGCCAGCCCCTGAAGAGCCTGTGCTCATTTTGTA