Transcript asmbl_26575

Sequence
Transcript Sequence for observation asmbl_26575 of TGE0004596:
GAAGGTTCTAGAAAAGCGGCAGCAGCGGCTCTAGCGGCAGTAGCAGCAGCGCCGGCTTGCTGTGCGGAGGTTCTCCTAGCGGTGTTGTTTCTCCAGCGGCGGCAGTTCTCACTACAGCGCCAGGACGAGTCCGGTTCGTGTTCGACCGCGGAGATCTCTCTCATCTCGCTCGGCTGCGGGAAATCGGGCTGAAGCGACTGAGTCCGCGATGGAGAAAACTTTAGAAACTGTTCCTTTGGAGAGGAAAAAGAGAGAAAAGGAACAGTTTCGTAAACTCTTTATTGGTGGCTTGAGCTTTGAAACCACAGAAGAAAGTTTGAGGAACTACTACGAGCAATGGGGGAAACTTACAGACTGTGTGGTAATGAGAGATCCTGCAAGCAAAAGATCGAGAGGATTTGGTTTTGTAACTTTTTCATCCATGGCTGAGGTCGATGCTGCCATGGCTGCAAGACCTCATTCGATTGATGGGAGAGTGGTTGAGCCAAAACGTGCTGTTGCAAGAGAGGAATCTGGAAAGCCAGGGGCTCATGTAACTGTGAAGAAGCTGTTTGTTGGTGGGATTAAAGAAGATACTGAGGAACATCATTTTAAAGATTACTTTGAGGAATATGGAAAAATTGATACCATTGAGATTATTACTGATAGGCAGTCTGGAAAGAAAAGAGGCTTTGGATTTGTTACTTTTGATGACCATGATCCTGTGGATAAGATTGTGTTGCAGAAATACCATACCATCAATGGTCACAATGCAGAAGTAAGAAAGGCTTTGTCTAGACAAGAGATGCAGGAAGTTCAAAGTTCTAGAAGTGGAAGAGGAGGCAACTTCGGTTTTGGAGATTCTCGTGGTGGCGGTGGAAATTTTGGACCAGGACCAGGAAGTAACTTTAGAGGAGGATCTGATGGCTATGGAAGTGGTCGTGGATTTGGGGATGGCTATAATGGGTATGGAGGAGGACCTGGAGGTGGCAATTTTGGAGGTAGCCCTGGTTATGGAGGAGGAAGAGGAGGATATGGTGGTGGAGGACCTGGATATGGCAACCAGGGTGGGGGCTACGGAGGTGGTTATGACAACTATGGAGGAGGAAATTATGGAAGTGGAAATTATAATGATTTTGGAAATTACAACCAGCAACCTTCTAACTATGGGCCAATGAAGAGTGGAAATTTTGGTGGTAGCAGGAACATGGGAGGACCATATGGTGGAGGAAACTATGGTCCTGGAGGAAGTGGAGGAAGTGGGGGTTATGGAGGGAGAAGCCGATATTAAGCTTCTTCCTATTTGCCATGGCATTGATATGAACCGTGGACAAGTATATTCTGCTGCCATAAAGACTGTAAAGTGCTTCATTTCAACAGCTGAGGCAAGCCAAGTGATCATTAATAAAGCTTTTCTTGGTTCCTTCAGTGGTGTTGGTAGTAAAATGGTAGGTAAAAGTTAGGCTGCAAGTTCAATAAATCATGAAATTTCCCATCGTTACACTCTTGTGTATTCACATTTCTTGGTTCAAGCATTTTGAAGTGAACTGGGGGTTTTATTAATAACGACATTTTGTTCTTTGATATGGTTTTAGCTTTACATGATTATCAGGATCAGGCTAAGGAGAAGGTAGGG