Transcript asmbl_26524

Sequence
Transcript Sequence for observation asmbl_26524 of TGE0029820:
CCGCCGGGACGGGAAGTGAGCCGCCAGGCCGCAGTGAGAGCGGGTCCCGCAGCCGCCTGCACCGGGGTGAAGCATGGCGGCCGCCAAGGTGGCTTTAACCAAGAGAGCAGATCCAGCTGAGCTTAGAACAATATTTTTGAAGTATGCAAGCATTGAAAAAAATGGTGAATTTTTCATGTCTCCCAGTGACTTCGTCACTCGATATTTGAACATTTTTGGAGAAAGCCAGCCGAATCCAAAGACTGTGGAGCTTTTAAGTGGTGTAGTGGACCAGACCAAAGATGGATTAATATCCTTTCAAGAATTTGTAGCATTTGAATCTGTCCTGTGTGCCCCAGATGCTTTGTTCATGGTGGCCTTTCAGCTGTTTGACAAAACTGGCAAAGGAGAAGTCACTTTTGAGGATGTTAAGCAAGTTTTTGAACAGACCACAATTCATCAGCATATTCCATTTAATTGGGATTCAGAATTTGTGCAACTACATTTTGGAAAAGAAAGAAAGAGACACCTGACATATGCAGAATTCACTCAGTTTTTGCTGGTGGGTCTAGCTCTTGAAAACTTAAAAAGAGTAAATAATTGATTTACCTCAG