Transcript asmbl_26416

Sequence
Transcript Sequence for observation asmbl_26416 of TGE0002528:
TTTTAAAAGTGGCACCAAGCATCTTGCTGTGTTTTTTCTTTAGTTTTTTAACTAGTGACTGGAAAGAGGGAGGGTTTCCAAGAATAAACCAAGTTGGATTACCTAGCGACTCCAGACACGTAAGAGGTCTAAAGAAAAAATTCACGGCAGTTTACTTTTCTGATTTTGAACCAAACATTTGGCCATTTTTAAAGAAATGCTGAATACGGTATAAATGGGATTTGAATTAGAAAAAAATTTGTCTATTTTCTGCCCTGTAAAGCTGTCTCGGATACCAACGTCCTCAGTAAGGTTTTCTAGACCCACTTGGTTAGGACACTGATATATTTTCAGGCACATAGCAGTAATGACGAATAGGAGCTTAACTCTGCTTATGTATGGATTTGTATACATGTTTGATAACGGGTTACATAGGTGGGGATTGAAATCCAAACTAAACGTGTTTAGTTACCTTTTTTGTATCATGCAAACTTCCTTTTAACTGTCATGCATTTTTCTAGTAATAGCTCTTCAAGTCTGCAATAAAAAATGGCCTCCAATAAAACCACATTGCAAAAAATGGGAAAGAAGCAAAATGGAAAAAGTAAAAAAGTCGAAGAGGCAGAGCCTGAAGAATTTGTGGTGGAAAAAGTACTGGACCGACGCGTCGTGAATGGGAAGGTGGAATATTTCCTGAAGTGGAAGGGGTTCACAGATGCTGACAATACTTGGGAACCTGAAGAAAATTTAGATTGTCCAGAGTTAATTGAAGCATTTCTAAATTCTCAAAAAGCTGGTAAAGAAAAAGATGGTACAAAAAGAAAATCTTTATCCGACAGTGAGTCTGATGATAGCAAATCAAAGAAGAAAAGAGATGCTGCTGACAAACCAAGAGGCTTTGCCAGAGGTCTTGATCCTGAACGAATAATTGGTGCCACAGACAGCAGTGGAGAATTAATGTTCCTCATGAAGTGGAAAGATTCAGATGAGGCAGATTTGGTGCTGGCAAAAGAGGCAAATATGAAGTGTCCTCAAATTGTAATTGCTTTTTATGAAGAGAGACTAACTTGGCATTCTTGTCCGGAAGACGAAGCCCAATAATTGTTTGC