Transcript asmbl_26388

Sequence
Transcript Sequence for observation asmbl_26388 of TGE0004565:
CCGCCGCTGCTGCTGCTGCTGCTGTCGCTGCCGGAATCGCCGCAGCTCCCAGCCTCGCGCGTCGCCGCTACCTTCTCGGACAGAAATTTTATGAATAAGCATCAGAAGCCAGTGCTAACAGGCCAGCGGTTCAAAACTCGGAAAAGGGATGAAAAAGAGAAATTCGAACCTACAGTCTTCAGGGATACACTTGTCCAGGGGCTTAATGAAGCTGGTGATGACCTTGAAGCTGTAGCCAAGTTTCTGGACTCTACAGGATCAAGATTAGATTATCGTCGCTATGCAGACACACTCTTCGATATCCTGGTGGCTGGCAGTATGCTTGCCCCTGGAGGGACACGCATAGATGATGGTGACAAGACCAAGATGACCAACCACTGTGTGTTTTCAGCAAATGAAGATCATGAAACCATCCGAAACTATGCTCAGGTCTTCAATAAACTCATCAGGAGATACAAGTATTTGGAAAAGGCATTTGAGGACGAAATGAAAAAGCTTCTCCTCTTCCTTAAAGCCTTTTCCGAAACAGAGCAGACCAAGCTGGCGATGCTGTCAGGCATCCTGCTGGGCAACGGCACCCTTCCTGCCGCCATCCTCACCAGTCTCTTCACCGACAGCTTAGTCAAAGAAGGCATTGCAGCCTCATTTGCTGTCAAGCTTTTTAAAGCATGGATGGCAGAAAAAGATGCCAACTCTGTTACCTCTTCTTTGAGAAAAGCCAACTTAGACAAGAGGCTGCTTGAACTCTTTCCAGTTAACAGACAGAGTGTGGATCATTTTGCTAAATACTTCACAGACGCAGGACTAAAGGAGCTTTCTGATTTCCTGCGAGTCCAGCAGCCCCTGGGCACCAGGAAGGAACTGCAGAAGGAGCTCCAGGAGGAGCGTCTTTCAGTGATGCCCGATCAAGGAGGTGGTGCTCTATGTGAAAGAAGAAATGAAGAGGAATGACCTTCCGGAAACAGCAGTGATTGGACTTCTGTGGACCTGTATCATGAATGCTGTTGAATGGAACAAGAAGGAGGAACTCGTGGCAGAGCAGGCCCTTAAGCACCTGAAGCAATACGCTCCCCTGCTGGCTGTGTTCAGCTCCCAAGGCCAGTCAGAGCTGATCCTTCTCCAGAAGGTTCAGGAATACTGTTACGACAACATCCATTTCATGAAAGCCTTTCAGAAGATCGTGGTTCTCTTTTACAAAGCCGATGTGCTGAGTGAAGAAGCAATTTTGAAATGGTACAAAGAAGCACACGTGGCCAAAGGCAAAAGTGTTTTTCTTGACCAGATGAAGAAATTTGTTGAGTGGTTACAAAATGCAGAAGAAGAATCCGAATCGGAAGGTGAGGAAAATTAGATGACTCGAGAAGCACAATACCTAGGGTTACTACACAATACTTTGATTGGGAATGCTGAACCATTCGAGAAGAGAAACTTGGCTTCTGTTTTCACAAAGGATTAAAAATAGGATAGGGTTCCCTTGTGCAGAAGGGGAAAAGTGGTTTTGTTTTCATTTTGTTTTTAAATGGAGCCCTGAGGCATCAGCTATTACACTTGGGACTCTACCTCTCACTCACTGTATGCTAACTTAAAGCCATTCAACAAGGAGTCAAGTAGGAATCTGAAAGTAAATACTCAACGGACTCCTCTTTTTTAGCTGTATTTTTCAGGTACTGTGTGGTGAATGCCCCACTGGTGTCTATTACAGGGCCACTTTGGTAGTTGTGTATCTGCTCGTGTATGTGATTTGACAAACCAGTTTTTTTAAATAAATGGCTTTATAAAAA