Transcript asmbl_25534

Sequence
Transcript Sequence for observation asmbl_25534 of TGE0001056:
CTAGTTGGATTTGCGCAGGCGCCTACGGAAGTGAGCAGAAGGAAGCGGAAGTCCCGCCTCTCGCGCTCTCTCTTCAGAGGCAGAAGCAACGCGGAGGGAACGCGAGCATTTCGAGAACGCAGCCGCTACCACCATGAGCCTCCTCAACAAGCCCAAGAGTGAGATGACCCCGGAGGAGCTGCAGAAGCGGGAAGAGGAGGAGTTTAACACGGGTCCACTCTCTGTGCTCACGCAGTCGGTCAAGAACAACACCCAGGTGCTCATCAACTGTCGCAACAACAAGAAACTCCTGGGCCGTGTGAAGGCCTTTGACAGGCACTGCAACATGGTGCTGGAGAATGTGAAGGAGATGTGGACCGAGGTCCCCAAGAGTGGCAAGGGCAAGAAGAAGTCCAAGCCCGTCAACAAGGACCGCTACATCTCCAAGATGTTCCTGCGCGGGGACTCGGTCATCGTGGTCCTGCGGAACCCGCTCATCGCCGGCAAGTAGGGGCGTCCTCCCTGCGGCGGAGCGCGGCCCCGAGCTGTGGGGGCCTTGCCTGTGAGATGGGAATAAAAGTCCTGTGTATTTTC