Transcript asmbl_2536

Sequence
Transcript Sequence for observation asmbl_2536 of TGE0029782:
ATCACAGCAGTCCAAGTGAACCAGAGCTTGCTGAGCCCCCTGAAGCTGGAGGTGGACCCCAACATCCAGGCCGTGCGCACCCAGGAGAAGGAGCAGATCAAGACCCTCAACAACAAGTTTGCTAACTTCATCGACAAGGTACGGAGCCTGGAGCAGCAAAACAAGATTCTGGAGACCAAGTGGAACTTTCTGCAGCAGCAGAAGACGATTCGCAGCAACATGGACAACATGTTTGAGAGCTACATCAACAACCTTCGACGGCAGCTGGACACGCTGGCCCAGGAGAAACTGAGGCTAGAGGCAGAGTGTGGCAACATGCAGGGGCTGGTGGAAGACTTGAAGAATAAGTATGAGGATGAGATCAACAAGCGCACAGAGATGGAGAATGAATTTGTCCTTATCAAGAAGGATGTGGATGAAGCTTACATGAACAAGGTAGAGCTGGAGTCTCGCCTGGAAGGGCTAACCGATGAGATCAACTTCTATAGGCAGCTGTATGAAGAGGAGATCCGTGAGCTGCAGGCCCAGATCTCTGACACGTCCGTGGTGCTGTCCATGGACAACAACCGCTCCCTGGACCTAGATGGCATCATCGCCGAGGTCAAGGCCCAGTACGAGGACATCGCCAACCGTAGCCGGGCTGAGGCTGAGACCATGTACCAGATCAAGTATGAGGAGCTGCAGACGTTGGCTGGGAAGCATGGAGATGACCTGCGTCGCACAAAGACAGAGATTTCTGAGATGAACCGGAACATCAGCCGACTCCAGGCTGAAATCGAGGCCCTCAAAGGCCAGAGGGCTTCCCTGGAGGCCGCCATCGCTGATGCCGAGCAGCGTGGGGAGCTGGCCCTCAAGGATGCTCAGGCCAAGGTGGCTGAGTTGGAGGCTGCTTTGAGAAATGCCAAGCAAGACATGGCCCGGCAGCTGCGCGAGTACCAGGAGCTCATGAACGTCAAGCTGGCCCTGGATGTGGAGATCGCCACCTACCGCAAACTGCTGGAGGGCGAGGAGAGCCGGCTGGAGTCTGGGATGCAGAACATGAGTATCCATACCAAGACTACCAGTGGCTACTCAGGTGGGCTGAGCCCGGCCTATGGAAACCTCACAAGTCCTGGCCTCAACTACGGTGTCAGCTTCCAGTCCAACTTCGGCTCTGGGGGGAGTTCCGGCTCTTTCAGCCGCACCAGCTCCACCAAGACCGTGGTGGTGAAGAAGATCGAGACTCGTGATGGGAAGCTTGTATCTGAGTCATCTGATGTCCTGCCTAAGTAAATGGCTACCGTGGTCCCTCTTGGCCTTTCAAGCCTGTGGGAAAGGAGCTGTGCAGAGAGCCTTGAACACAGGAGACCCACCTGAAGCTCAGCCCCAGTTCTCAGCCCCAACCCTGGGTGGGGAATCTACTGCCTGGAGGACCGCCTCTTACCCACGCCCCTAACTAAAAGCCAAATCAAGTGTTTTTTCCAAAATAAAGTCTCAGCTGGCTCTGCCAACCTTA