Transcript asmbl_23714

Sequence
Transcript Sequence for observation asmbl_23714 of TGE0004335:
GACATGTCCTTCCGAAAAGTGGTTCGGCAGAGCAAATTCCGGCATGTGTTTGGGCAGCCGGTCAAGAATGACCAGTGTTATGAGGACATCCGAGTGTCCCGTGTCACCTGGGACAGCACCTTCTGCGCTGTCAACCCCAAGTTCCTGGCAGTGATTGTGGAGGCCAGTGGTGGAGGCGCCTTCCTGGTGCTCCCTCTAAACAAGACGGGCCGCATTGACAAGGCCTACCCAACGGTGTGTGGGCACACGGGACCTGTCCTGGACATCGACTGGTGTCCCCACAACGACGAAGTCATCGCCAGCGGCTCGGAGGACTGCACAGTCATGGTGTGGCAGATCCCAGAGAATGGGCTGGCCTCCCCGCTGACAGAGCCCGTGGTGGTGCTGGAGGGGCACACCAAGCGAGTGGGCATCGTCACCTGGCACCCGACGGCCCGCAATGTGCTGCTCAGCGCAGGCTGTGACAATGTGGTGCTCATCTGGAACGTGGGCACGGCGGAGGAGCTGTACCGCTTGGACAGCCTGCACCCCGACCTCATCTACAATGTCAGCTGGAACCGCAACGGCAGCCTCTTCTGCTCCGCCTGCAAGGACAAGAGCGTGCGCATCATCGACCCCCGCCGGGGCATCCTGGTGGCGGAGCGAGAGAAGGCTCACGAGGGCGCCCGGCCCATGCGGGCCATCTTCCTGGCGGATGGCAAGGTGTTCACCACCGGCTTCAGCCGCATGAGCGAGCGGCAGCTGGCGCTCTGGGACCCAGAGAACCTCGAGGAACCAATGGCCCTGCAGGAGCTGGACTCTAGCAACGGGGCTCTGCTGCCCTTTTACGACCCTGACACCAGCGTGGTCTACGTCTGTGGCAAGGGCGATTCCAGCATCCGGTACTTTGAGATCACAGATGAGCCCCCCTACATCCACTTCCTGAACACGTTCACCAGCAAGGAGCCCCAGAGGGGCATGGGCAGCATGCCCAAGAGGGGCCTGGAGGTCAGCAAGTGCGAGATCGCCCGATTCTACAAACTGCACGAGCGCAAGTGCGAGCCTATTGTCATGACTGTGCCAAGAAAGTCGGACCTCTTCCAGGATGACCTGTACCCTGATACGGCCGGGCCCGAGGCGGCCCTGGAGGCAGAGGAGTGGGTGAGCGGGCGGGACGCCGACCCCATCCTCATCTCCCTGCGGGAGGCCTACGTGCCCAGCAAACAGCGGGACCTGAAGGTCAGCCGGCGGAACGTGTTGTCTGACAGCCGGCCTGCTGTGGCCCCGGGCTCCGCGCGCCTGGCGGCCTCCACACCTGCCACCTCCACCCATACGACTGCCCCCAGCAGCAGCCTCGCTGGGGCCGGGGAGGCTGGGAAACTGGAGGAGGTGATGCGGGAGCTGCGGGCACTGAGAGCGCTGGTCAAGGAGCAAGGGGAGCGCATCGGCCGCCTGGAGGAGCAGCTGGGCCGCATGGAGAATGGGGACGCCTAGGACCATAGGCCCAGTGGATGCCACGCCCCCTCACCTCCTCCTCCTCCACCCACTTCTCACTCAGCCTCTGCTGGCAGGCCACACCGATAGCTGGCTGCCCCCTGCCCCCTGCCCCCTGCCGAGGGCCTCTGGGGCAGGCTCGGGGCCAGCCCACACCCTGATCCATCCTGTGGGCCAGGCTGGAGCCACCGCCTGGCTTTTGTCTTTGTTACTGTGGAGGATTTTTGTACCAAGGCGAGCTTATGTGAGGGACCCTCTCTCCACACGCCCACCCGCCCCCTGCTCCCTCCCGGAGGAGTGGGAGGGATGGGCTCTATATTTTCATTCCAAATAAAATTCACTTTCTAAAA