Transcript asmbl_24531

Sequence
Transcript Sequence for observation asmbl_24531 of TGE0004477:
GGGAACTACCGCACCCAGATGTGGGATAAGCACAAGGAGGTCTTCCTGCCCTCGACCCCCGGCCTGGGCATGCACGTGGAGGTGAAGGACCCTGAAGGCAAGGTGGTGCTCTCGCGGCAGTATGGCTCCGAGGGGCGCTTCACCTTTACTTCCCACACCCCTGGCGACCATCAGATCTGCCTGCACTCCAACTCTACCAGGATGGCGCTCTTCGCTGGCGGCAGACTGCGTGTGCACCTGGATATCCAGGTCGGGGAGCATGCCAACAACTACCCAGAGATTGCTGCCAAGGACAAGCTGACAGAGCTGCAGCTGCGGGCCCGCCAGCTGCTCGATCAAGTGGAACAGATCCAGAAGGAGCAGGATTACCAGCGGTACCGAGAAGAGCGCTTTCGTCTGACCAGTGAGAGCACCAACCAGAGGGTCCTGTGGTGGTCCATCGCTCAGACCGTCATTCTCATCCTCACTGGCATCTGGCAGATGCGTCACCTCAAGAGCTTCTTTGAGGCCAAGAAGCTGGTGTAGCGTTCTCTCTGTGTGACCTTTCTCTCTCATCTCAATTATTTGGTACTTTCCCCACCCGATACCTTATCCACTTGAGTTGTGAGGGGAAAAAATGGAGAAAGGATTTAAGCCACATTGGTTTCATGGCAGCAAAGCATCCAGATCGGCCACCCATTAACATTGGATACAGGACATTGGTCCAAGCTTTCACAGGTGTCTTGGGGTTTGCGCACAGTCGGAACTGACCCTGGACTAGGCCTTGCTTCTTGCGCCTCCAGTGAGTCCCCTTCATCCCATCACAAAATGAGCAAAGGAAAAATCCTCCCAACTCCTGTAACTTTCTGTCCTCGTCTGCTCACACAGCGGCGACGGAAATGCCCCACCAAGGAGGCCCCACCTCACTGCTCCCGGTTGGTCCTGGGTTCCCTCAGTGGCTTTCTGAATGTAAATAAGGGCCAGAGGCCTTAGAAGATGGAAGTGTTTTTCTATATATTAGAAGTATTTTTTGATAAATTATATATTTTCCTTCCTAGCTGAAGTGTGACTGCCTGTGTGTGACTAACTGAGCCACAGCGCAGCCACCCCACACTCTGTTTGCCCACAGTTCTGGTGACTTCCGCAGCAGCTCAGGATTTCAGCGGGTCGCACAGCCGACGCCCCAGCTGCTCTCAAGGCCTTAGCAGAGGGCTAAGGAGACCCTCTGGGACACCTGTGCCTCCACCGCACGGGGCCTCAGGGTGATGACAGAGCCGGCACTGGCGGGGCGCTCCTCTCTTCCTCGCCCCTTCACCTGTGGTTAAGCCGTGGTAAATGTTTTCTTCAAGGGAACCAGGGTTGGTTCTTTATACAGATTTTTCCAGTGAAATAAAACTTGTTGCAGTA