Transcript asmbl_17440

Sequence
Transcript Sequence for observation asmbl_17440 of TGE0000441:
CGCAGCCCGCCGCCCCAGCCATGGCGAAGCCCCTGACGGACCAGGAGAAGCGGCGGCAGATCAGCATCCGCGGCATCGTGGGCGTGGAGAACGTGGCAGAGCTGAAGAAGAGTTTCAACCGGCACCTGCACTTCACGCTGGTCAAGGACCGCAACGTGGCCACCACCCGCGACTACTACTTCGCGCTGGCGCACACGGTGCGCGACCACCTGGTGGGGCGCTGGATCCGCACGCAGCAGCACTACTACGACAAGTGCCCCAAGAGGGTATATTACCTCTCTCTGGAATTTTACATGGGCCGAACATTACAGAACACCATGATCAACCTCGGTCTGCAAAATGCCTGTGATGAGGCCATTTACCAGCTTGGATTGGATATAGAAGAGTTAGAAGAAATTGAAGAAGATGCTGGACTTGGCAATGGTGGTCTTGGGAGACTTGCTGCCTGCTTCTTGGATTCCATGGCAACCCTGGGACTTGCAGCCTATGGATACGGCATTCGGTATGAATATGGGATTTTCAATCAGAAGATCCGAGATGGATGGCAGGTAGAAGAAGCAGATGATTGGCTCAGATATGGAAACCCTTGGGAGAAGTCCCGCCCAGAATTCATGCTGCCTGTGCACTTCTATGGAAAAGTAGAACACACCAACACCGGGACCAAGTGGATTGACACTCAAGTGGTCCTGGCTCTGCCATATGACACCCCCGTGCCCGGCTACATGAATAACACTGTCAACACCATGCGCCTCTGGTCTGCTCGGGCACCAAATGACTTTAACCTCAGAGACTTTAATGTTGGAGACTACATTCAGGCTGTGCTGGACCGAAACCTGGCCGAGAACATCTCCCGGGTCCTCTATCCCAATGACAATTTTTTTGAAGGGAAGGAGCTAAGATTGAAGCAGGAATACTTTGTGGTGGCTGCAACCTTGCAAGATATCATCCGCCGTTTCAAAGCCTCCAAGTTTGGCTCCACCCGTGGTGCAGGAACTGTGTTTGATGCCTTCCCGGATCAGGTGGCCATCCAGCTGAATGACACTCACCCTGCACTCGCGATCCCTGAGCTGATGAGGATTTTTGTGGATATTGAAAAACTGCCCTGGTCCAAGGCATGGGAGCTCACCCAGAAGACCTTCGCCTACACCAACCACACAGTGCTCCCGGAAGCCCTGGAGCGCTGGCCCGTGGACCTGGTGGAGAAGCTGCTCCCTCGACATTTGGAAATCATTTATGAGATAAATCAGAAGCATTTAGATAGAATTGTGGCCTTGTTTCCTAAAGATGTGGACCGTCTGAGAAGGATGTCTCTGATAGAAGAGGAAGGAAGCAAAAGGATCAACATGGCCCATCTCTGCATTGTCGGTTCCCATGCTGTGAATGGCGTGGCTAAAATCCACTCAGACATCGTGAAGACTAAAGTATTCAAGGACTTCAGTGAGCTAGAACCTGACAAGTTTCAGAATAAAACCAATGGGATCACTCCAAGGCGCTGGCTCCTACTCTGCAACCCAGGACTTGCAGAGCTCATAGCAGAGAAAATTGGAGAAGACTATGTGAAAGACCTGAGCCAGCTGACGAAGCTCCACAGCTTCCTGGGTGATGATGTCTTCCTCCGGGAACTCGCCAAGGTGAAGCAGGAGAATAAGCTGAAGTTTTCTCAGTTCCTGGAGACGGAGTACAAAGTGAAGATCAACCCATCCTCCATGTTTGATGTCCAGGTGAAGAGGATACATGAGTACAAGCGACAGCTCTTGAACTGTCTGCATGTGATCACGATGTACAACCGCATTAAGAAAGACCCTAAGAAGTTATTCGTGCCAAGGACAGTTATCATTGGTGGTAAAGCTGCCCCAGGATATCACATGGCCAAAATGATCATAAAGCTGATCACTTCAGTGGCAGATGTGGTGAACAATGACCCTATGGTTGGAAGCAAGTTGAAAGTCATCTTCTTGGAGAACTACAGAGTATCTCTTGCTGAAAAAGTCATTCCAGCCACAGATCTGTCAGAGCAGATTTCCACTGCAGGCACCGAAGCCTCGGGGACAGGCAATATGAAGTTCATGCTAAATGGGGCCCTAACTATCGGGACCATGGATGGGGCCAATGTGGAAATGGCAGAAGAAGCTGGGGAAGAGAACCTGTTCATCTTTGGCATGAGGATAGATGATGTGGCTGCTTTGGACAAGAAAGGGTACGAGGCAAAAGAATACTATGAGGCACTTCCAGAGCTGAAGCTGGTCATTGATCAAATTGACAATGGCTTTTTTTCTCCCAAGCAGCCTGACCTCTTCAAAGATATCATCAACATGCTATTTTATCATGACAGGTTTAAAGTCTTTGCAGACTACGAAGCCTATGTCAAGTGTCAAGATAAAGTGAGTCAGCTGTACATGAATCCAAAGGCCTGGAACACAATGGTACTCAAAAACATAGCTGCCTCGGGGAAATTCTCCAGTGACCGAACAATTAAAGAATATGCCCAAAACATCTGGAACGTGGAACCTTCAGATCTAAAGATTTCTCTATCCAATGAATCTAACAAAGTCAATGGAAATTGAACTCTAGAATTGTCTCTAGAAAACATAGCTTCTTACTGAACTTGAACATTTTTACAACATTCACTGGTTTTTGTTTTGTTAGCTAATAATCTATAATAGTTGAGTATCTCTGGGAATGGGGAGGGAAATTATATGTAATAGAGCTTAAAAATAAAGTGTCAATTTCCAAGGGC