Transcript asmbl_23440

Sequence
Transcript Sequence for observation asmbl_23440 of TGE0004430:
GGGGAAGCGGTGGAGAAGGGTAGGGTAGGGTAGCTGAGCAAGTTCGTTCACCTTAGTCCGACTCTTCGTCGTGAGAGAAGCTGGCCAAGGGGGCCGGGGCTTGCACTACACTTCCCGGGAGGCTGTGCGCAGCGGCGCGTCCCGTAACGGGAGCGCGGGCTTTGGAAGGCAGCGGAGCGAGAGGTGATCTGCGGCTGAGCTGAAGCGGTAGCGGGGCTGAGGACTGTCCTGGGCGACACCGGACCAAGCGCTAGCTGCCGAGGCCTCGTGCCCCTAGGCCAGCCGTTCCTCCTCCGTGTCGCTATGGGTATTCAAGGCCTGGCCAAACTGATTGCTGATGTGGCCCCCAGTGCCATCCGGGAGAATGACATCAAGAGCTACTTCGGCCGCAAGGTGGCCATCGATGCCTCCATGAGCATTTATCAGTTCCTGATTGCCGTTCGCCAGGGTGGGGATGTGCTGCAGAATGAGGAGGGTGAGACCACCAGCCACCTGATGGGCATGTTCTACCGCACCATCCGCATGATGGAGAACGGCATCAAGCCCGTGTATGTCTTCGATGGCAAGCCGCCACAGCTCAAATCGGGTGAGCTGGCCAAACGCAGCGAGCGGCGGGCTGAGGCCGAGAAGCGGCTACAGCAGGCTCAGGATGTTGGGACTGAGGAGGACGTGGAGAAGTTTACTAAGCGACTAGTGAAGGTCACCAAGCAACACAATGATGAGTGCAAGCATCTACTGAGCCTCATGGGCATCCCGTACCTCGATGCGCCCAGCGAGGCAGAGGCCAGCTGTGCAGCCCTGGTGAAGGCTGGCAAAGTCTATGCTGCGGCCACGGAGGACATGGATTGCCTGACCTTTGGCAGCCCTGTGCTAATGCGGCACCTGACTGCCAGCGAGGCCAAGAAGCTACCCATCCAGGAATTCCACCTGAGCCGGATTCTTCAGGAGCTGGGCCTGAACCAGGAGCAGTTTGTGGACCTCTGCATCCTGCTGGGCAGCGACTACTGTGAGAGCATTCGAGGCATTGGGCCCAAGCGGGCTGTGGACCTCATCCAGAAGCACAAGAGCATCGAGGAGATCGTGCGTCGACTTGACCCCAGCAAGTACCCCGTGCCGGAAAACTGGCTCCACAAAGAGGCCCAGCAGCTCTTCCTAGAGCCTGAGGTGCTGGACCCAGAGTCTGTGGAGCTGAAGTGGAGTGAACCAAACGAAGAAGAGCTCGTCAGGTTCATGTGCGGCGAAAAGCAGTTCTCCGAGGAGCGAATCCGCAGTGGGGTCCGGCGGCTGAGCAAGAGCCGCCAGGGCAGCACGCAGGGCCGCCTGGATGATTTCTTCAAGGTGACCGGCTCGCTCTCGTCAGCGAAGCGCAAGGAGCCCGAACCCAAGGGATCCGTGAAGAAGAAGGCGAAGACTGGGGCGGCAGCAGGGAAGTTTAAGAGGGGAAAATAAACAAGTTCCCCTTCAGTACACCTCCGTGCCCAGAGTTATCTGCCCCGTCCCCTTGAGGGCTGGCACTGGAGAAGCCTCCCCTGGGGCAGGGAGGGGACTGCGTTGCTTCTGTGGCATGCGCCTTCTCAGTACTGCAGTTCCCTTTTTTACTTGATCTTATGGCAGGAAAGCCGCAGAGGTACTTTGTTTTCTTCTTTTTTTAGCTCAGGAAAGTATGTCAGCCTCAAACTACCTTTCACTTTAATGGACACTGAATTCATTGTTACGTAAAAGTGATAGCAACAGGTTTTGAAGAAGGGAGAGGGAGAGAAATGGTGGAGACAAAAGACTTTACAGAAGTGATTTCCTGGCTGGCCAGCCGGTGGCCGGTGATGGCGGAACCAGACCACGCTTCTCTGGTTCAGCCTTGACCCACCATGAAGGAAGGACAGCCGGCAGGAAGACCCGGTCTTAGCAAATAGGAAGAGCTACTAAGAAATAAGACAGGCAGAGAGCTGGAGTACATGGACTTGGCAACAAGGGTTCGATTACTGGCTGTGTGTCCTGGGGTGGGCAGAAACTTGAACTTGCTGTGTAACTTGAGTCTTTAGTCATTATTTAGAGGCATAAGGTGGTGAAGTTCTTCTCATGGCCTTTCTGAGGCAATCAACTGAGTCGAGACTTTGGGAAAAGATGCTGTTATGTTTTTGTTTTAAGGTTATGAGAAAAGAGTCAATAAAATTATAAAAGTAA