Transcript asmbl_23432

Sequence
Transcript Sequence for observation asmbl_23432 of TGE0004427:
NNNNNNNCCAGCCCGGGCCGGCGCGGCAGGGAGAACGCGGGAGCCAGGGCGACGCTCTGGGCTCTTCTTTCAAAGTTCAACCCGAGCCGCCGCATTTCCCCGCTGCCCCTTGGTCTCAGGAAATTGCACGAACTGTACACCCTGCCTCCTCTCCCGGAGCAGACTTTGGACCTGTCCTCAACGGCCCCGTGCGGATTTCCTGGGCCCATTTGAAATGACGTTCTCGTCTTCCTGATCCCTAGGATCCGTCGACATGAATCCCGTCGTCGTGGTCCACGGCGGCGGAGCCAGCAACATCTCCAAGGACCGCAAAGAGCGGGTGCGCCAGGGCATCATCCGAGCCGCCACCGTGGGTTACAACATCCTCAAGGAGGGAGGGAGCGCAGTTGACGCTGTGGAAGGAGCCGTGACCGTCCTGGAAGATGACCCCGAGTTCAACGCAGGTTGTGGATCTGTCTTGAACGTCAATGGTGAAGTCGAAATGGATGCCAGTATCATGAATGGAAAAGACCTGTCTTCGGGAGCTGTGTCTGCAGTCCGGTGCATCGCAAACCCCATCAAGCTTGCGCGGCTTGTTATGGAAAAGACACCTCATTGCTTCCTGACTGACCAAGGTGCAGCAAAATTTGCTGCAGACATGGGGATTCCAGAAGTTCCCGAGAAGCAACTGATAACAGAGAGAAACATAAAACACCTAGAAAAAGAGAAGAATGAGAAAAGTGCTCAGAAAACAGACCAACAAAAAAACTTGGGAACTGTGGGCGCCGTCGCCTTGGACTCCGAAGGAAACGTGGCTTACGCGACCTCGACGGGGGGCATCGTGAATAAGATGGCCGGCCGAGTCGGGGACACGCCGTGTATAGGATCTGGAGGTTATGCTGACAATGACATTGGAGCCATTTCCACGACGGGGCACGGGGAAAGCATCCTGAAGGTGAATCTGGCCAGACTCACGCTCTTCCACAGAGAACAAGGAAAGACGCTGGAAGAGGCCGCTGACTCGTCGCTGGGTTACATGAAGTCGAAGCTCAAAGGTTTAGGTGGCGTCATCCTGATCAACACAGCAGGAGACTGGGCAGTAAAGTGGACCTCGGCGTCCATGCCCTGGGCCGCCGCCAAGGACGGCAAGCTGCACTCCGGCATTGACCTTGACGAAACCAGTATTGCTGACCTGCCCTAAGCCCCTGGGAGATCGTGTGCTAGGTGCTAGCGTGGAGGTAAAGTGCAGCTTCCTGACGTGGAGACTTAGCTTAACCAATTAGATCTAGAAATGGAAAAAGCCTACAGTCTGTCACTCGTTTCGTTGCCTTGATCAATAAGCACCCGAATGTGTGGCGAGGGGCGGATTCCACAGTGACAGAGAAATCACAGCTGGGGGCCGCCGGGCTTGCTGGCGCCTACGACTCAGGTCGTTCAACGAACCTGCGTTGTGACGACTGAGGTGCCCGTTGCTGGGCTGACCCAAGCCTCATCTCTCCCTGCCCTTTGTTTCCCAAAAGGCCGGGGTCTGAGCTCCCGCAGATTGTCCTGAGTTTCCGGTCAGTGGACTGACCGCATCCTCCCAGACCTCGTTGCACAGATACCTCCACTTTAAGAATTCTTTCACTTTGTTCACAAAACAAAGAAACCACAACAACCCTCCCTCCCCACCCCATCACCCAGAAATCCCCAAGCAACCAACCAACGAAAACCCAGCTGGTCTCCGTCTCCCTCGTTTCCTTCTAGAGAGTCGCTCTCCTAAATAAATACCTTAAGCTCGATGACTGACTCCCATCGCCCTTTTTCTGGCACAATCCCATCCTCGGATGGCC