Transcript asmbl_23366

Sequence
Transcript Sequence for observation asmbl_23366 of TGE0004412:
CGGGACTGAAAACGGCTGCCGGAGGGGGCTACGGGGATCATGGGCCTTTTGACCATCCTGAAGAAGATGAAGCAGAAAGAGCGGGAGCTGCGACTGCTCATGCTTGGCCTGGACAATGCTGGCAAAACAACCATCCTCAAGAAGTTCAATGGAGAGGACATCGACACCATCTCTCCAACGCTGGGCTTCAACATCAAGACCCTGGAGCACCGGGGATTCAAGCTGAACATATGGGATGTGGGCGGCCAGAAGTCCCTGCGCTCCTACTGGCGAAACTACTTTGAGAGCACGGATGGCCTCATCTGGGTGGTGGACAGCGCTGACCGCCAGCGCATGCAGGATTGCCAGCGCGAGCTCCAGAGCCTGTTGGTGGAGGAGCGCCTGGCCGGAGCCACCCTCCTCGTCTTTGCCAACAAGCAGGACCTTCCCGGAGCACTGTCCTCTAATGCCATCCGTGAGGCCCTGGAGCTGGACTCCATCCACAGCCACCACTGGTGCATCCAGGGCTGCAGCGCCGTCACTGGGGAGAACCTGCTGCCCGGCATTGACTGGCTCCTGGATGACATTTCCAGCCGCATCTTCACGGCCGACTGAGCCGCTCCAGACGCCCCGACATCACAGTCTGGGTCGTCCCTTCTACCCCCTGGCCCTCACCAAGCACCATCCGTGGGAGGATGGGAATCAGCCAGCCCAACTAACACTCCCCAACCCCTCCGTAACCTGCTGCCGCCGCCCGCTGCTGCTCCGTGGCCAGCCAGCTCCCATGACAGGAGGGCTGCCCTCCTGGCTGTCACCCTGGCTCCTGACCTGGCCCTGCAGCTGCCATACCAAGAGGTGAGGGTTGGGGCTGGGCGGGGGCTGTCTCTGCTGCTATGGAGGCTGTGGGCCTCGTCCTTTGCTCAGCTGTAAGAATAAAC