Transcript asmbl_23353

Sequence
Transcript Sequence for observation asmbl_23353 of TGE0029725:
CTGCCCTGAGCTGCCACCCGGGAAGCCAGCCTCAGGGACCGCAGCGATCCCCTAAACACTCCTCCAGGATGGCTGAGGAGTTTATCACCCCTGTGTACTGCACCGGGGTGTCTGCACAAGTGCAGAAGCTGCGGGCCAAGGAGCTGGGCCTGGGCCGCCATGAAAACGCTATCAAGTACCTGGGCCAGGATTACGAACAGCTGCGGGCTCAGTGTCTGCAGAGTGGGACCCTCTTCCGGGATGATGCCTTCCCCCCAGTGCCCCAGAGCCTGGGCTACAAGGACCTGGGCCCCAACTCCTCCAAAATCTATGGCATCAAGTGGAAGCGTCCCACGGAGCTGCTCTCCAACCCCCAGTTCATCGTGGATGGAGCCACCCGCACAGACATCTGCCAGGGAGCACTGGGGGACTGCTGGCTCCTGGCTGCCATCGCCTCTCTTACCCTCAATGACACCCTCCTGCACCGAGTGGTTCCGCATGGCCAAAGCTTCCAGGATGGCTACGCTGGCATCTTCCATTTCCAGCTGTGGCAGTTTGGGGAGTGGGTGGACGTCGTCGTGGATGACCTGCTGCCCATCAAGGACGGGAAGCTGGTGTTCGTGCACTCTGCCCAAGGCAATGAGTTCTGGAGCGCCCTGCTCGAGAAGGCCTATGCCAAGGTAAATGGCAGCTACGAGGCCCTATCAGGTGGCAGCACCTCGGAGGGCTTTGAGGACTTCACAGGCGGTGTCACCGAGTGGTATGAGCTGCGCAAGGCGCCCAGCGACCTCTACCAAATCATCCTCAAGGCGCTGGAGCGGGGCTCCTTGCTGGGCTGCTCCATTGACATCTCCAGTGTTCTAGACATGGAAGCCGTCACCTTCAAGAAGCTGGTGAAGGGCCACGCTTATTCTGTGACTGGGGCCAAGCAGGTGAACTACCAGGGCCAGATGGTGAGCCTGATCCGGATGCGGAACCCGTGGGGCGAGGTGGAGTGGACAGGAGCCTGGAGTGACCGCTCCTCGGAGTGGAACAATGTGGACCCTTATGAACGCGAGCAGCTCCGGATCAAGATGGAGGACGGGGAGTTCTGGATGTCATTCCGAGACTTCATGCGCGAGTTCACCCGCCTGGAGATCTGCAACCTGA