Transcript asmbl_23350

Sequence
Transcript Sequence for observation asmbl_23350 of TGE0004407:
GTGCACTGCTAGTGACGTGCCTGACACGTGTTCCAGTTGTTTGCGTACCTGCCTGTCTGCACCAGCTGACGGGATTCTCTGAAGATGGGGATGAGGTCTCCTCATCTTGGATTCCCAGAGTCGCACACAGAAGACTCTCAATCTGACCTCTGAGGCATTTTCCCTAACTGTCCTTTCTCCCACCATCCCAGTATCTTCTAATCAACGCCTTACGGTCCTTTCTATCTTAGACTTTGAGCAGAACATGGTCCTGGTGGCCTGTGGACCATACACCACGTCTGACAGCATCACATATGACCCCCTGCTCGACCTGATCACCATCATCAACCACGACCAGCCAGACATCTGCATCCTGTTTGGCCCTTTCCTGGATGCTAAGCATGAACAGGTTGAGAACTGTCTGCTGACGAGTTCGTTCGAAGATGTTTTCAAGCAGTGTCTACGAACAATTGTCGAAGGGACTCGAAGCTCCGGCTCCCACCTCGTCTTTGTCCCGTCGCTGAGAGATGTCCAGCACGAGCCCGTGTACCCACAGCCACCTTTCAGCTACTCCGACCTGCCTCATGAGGACAGGAAGCGAGTGCAGTTCGTGTCTGACCCCTGCAGCCTCTCCGTGAATGGTGTGGTCCTTGGCCTGACGTCCACGGATCTGCTGTTCCACATGGGGGCCGAGGAGATCAGCAGTTCTTCTGGAACTTCAGACAGATTCAGCCGAATACTGAAGCACATCCTGACCCAGAGGAGCTACTACCCGCTCTACCCTCCCCAGGAAGACATGGCCATTGACTACGAGAGTTTCTGCGCCTACGCACAGCTGCCCGTCACCCCGGATGTCTTCATAGTCCCGTCAGAGCTGAGGTACTTCGTGAAGGACGTCCTTGGCTGTGTCTGCGTGAATCCTGGACGCCTCACCAAAGGGCAGGTGGGGGGCACCTATGGCCGGCTCTACCTCAGGAGGCAGACCCCAGAGGCCGGGGAGGGGAGGCGGAGTCCATGTGTTGCTGCCCAGGTGGTCAGGATCTGAGCCTTCAGGCACTTTGTCCCCCACTGTGCGGGCCTGGAGGCCCTAGGACCCAGGACTATCTGACAAGATTCCGCCCCGTTGGAAGGTGAAGAAGAGGAGGCGGCCACAGCTGGGGCGTGGAGGCCGCGGGGGCGGGCCCAGCACAGAAGACATCATGCAGCCGTCTCGGACTTCGAGTGAGCTCCATTGGAAGAACGCCTTTGCTCCTGATACACGGATTATAACGTGAACTGCCTGTGGATGCAGCACACTTGGAAAAAGCGAGAAGGCTTTATGACCTTCTACACGAATAAGACAACTTTTGGAGAAATA