Transcript asmbl_23348

Sequence
Transcript Sequence for observation asmbl_23348 of TGE0029724:
CCGCAGCTTAGCTTTTTTCCTGTTTTCAAGGGTGTGCCACTTCCATTTTATCAGCCCACCGAAGAGGAGGGAGACTTTGAGCAGAACATGGTCCTGGTGGCCTGTGGACCATACACCACGTCTGACAGCATCACATATGACCCCCTGCTCGACCTGATCACCATCATCAACCACGACCAGCCAGACATCTGCATCCTGTTTGGCCCTTTCCTGGATGCTAAGCATGAACAGGTTGAGAACTGTCTGCTGACGAGTTCGTTCGAAGATGTTTTCAAGCAGTGTCTACGAACAATTGTCGAAGGGACTCGAAGCTCCGGCTCCCACCTCGTCTTTGTCCCGTCGCTGAGAGATGTCCAGCACGAGCCCGTGTACCCACAGCCACCTTTCAGCTACTCCGACCTGCCTCATGAGGACAGGAAGCGAGTGCAGTTCGTGTCTGACCCCTGCAGCCTCTCCGTGAATGGTGTGGTCCTTGGCCTGACGTCCACGGATCTGCTGTTCCACATGGGGGCCGAGGAGATCAGCAGTTCTTCTGGAACTTCAGACAGATTCAGCCGAATACTGAAGCACATCCTGACCCAGAGGAGCTACTACCCGCTCTACCCTCCCCAGGAAGACATGGCCATTGACTACGAGAGTTTCTGCGCCTACGCACAGCTGCCCGTCACCCCGGATGTCTTCATAGTCCCGTCAGAGCTGAGGTACTTCGTGAAGGACGTCCTTGGCTGTGTCTGCGTGAATCCTGGACGCCTCACCAAAGGGCAGGTGGGGGGCACCTATGGCCGGCTCTACCTCAGGAGGCAGACCCCAGAGGCCGGGGAGGGGAGGCGGAGTCCATGTGTTGCTGCCCAGGTGGTCAGGATCTGAGCCTTCAGGCACTTTGTCCCCCACTGTGCGGGCCTGGAGGCCCTAGGACCCAGGACTATCTGACAAGATTCCGCCCCGTTGGAAGGTGAAGAAGAGGAGGCGGCCACAGCTGGGGCGTGGAGGCCGCGGGGGCGGGCCCAGCACAGAAGACATCATGCAGCCGTCTCGGACTTCGAGTGAGCTCCATTGGAAGAACGCCTTTGCTCCTGATACACGGATTATAACGTGAACTGCCTGTGGATGCAGCACACTTGGAAAAAGCGAGAAGGCTTTATGACCTTCTACACGAATAAGACAACTTTTGGAGAAATA