Transcript asmbl_23347

Sequence
Transcript Sequence for observation asmbl_23347 of TGE0029723:
CGGGATTTTCCCGGCGGCCGTGTTCTACTGGGGTCTTTGGGATGCTTAGCGTTGGAGGCTTCCCCCACATTGTTTTAAAAAGTGTTTCTCCGTGACTGACCGCTGGGGCTTTCTGACCGCCTGAGGTCTTGGGCTATTTGGTCACCTTCCTTCTCGGTCCCCCAGAGGGCAAAAGGACCAGAGTGACCTCCTGCTGATCGATCTCCACACCCGAGGGTTTCTTGGACTCAGGTCGGAGCTGTGTGGACCCGCCCCCACTCCTGTGTCACCATGTCCGTGTCCACCCAGCAGCTGGCCGAGGAGATGCAGATCTTCGGCCTAGAGTACGAGGAGCCTCTGATTGAGAAATTGGCGGAGCTGTGCGTTCTGCATGGAGAGAATGAGGCGGGAATGGTAGGCGAGCTCATAGCCTTCTGCACCAGCACGCAGAAAGATCGCCTCACCGCAGAGACCCTGAACTCTTTTGAGCATGAGGTTCTGAGCAAAAGATTGGCCAGATCCCGGCACAGTGCCTCCAAGGACAGTGGGCACGCGGGAGCTAGAGACATCATTTCCATACAAGAGCTAATCGAAGTGGAGGAGGAAGAGGAGACCCTTCTGAATGCCTATTCCACACCCTCCAAGGGTTCTCAGAAGCGAGCTGTCACCACCCCAGAAACCCCCCTAACCAAAAGGAGAGTGTCTGCTCGCAGCCCCCACCAGCTCCTCTCACCATCGAGTTTCTCTCCAAGTGCTACTCCCTCTCAGAAATACAACTCGAGGAATAACCGAGGAGAAGTGGTTACCTCCTTCGGCTCGGCCCAGGGAGTGTCTTGGTCCGGGAGAGGAGGAGCCGGCATCATCAGCCTAAAGGTCTTGGGGTGTCCAGAGTCACTAACCGGGAGCTACAAATCAATGTTTCAGAAGCTGCCAGACATTCGAGAAGTTCTGACCTGTAAGGTAGAAGAACTTGGCAGTGAACTCAAGGAACATTACCAGATCGAGGCTTTTGCTCCTGTTCTAGTTCCAGCACAAGAGCCCGTCACTCTGCTGGGCCAGATTGGCTGTGATAGCAACGGGAAGCTGAACAACAAGTCGGTGATTCTAGAGGGGGACCGGGAGCATTCTTCCGGCGCTCAAGTTCCAGTGGATTTATCTGAGCTCAGAGAATACTCTCTGTTTCCTGGACAGGTTGTAATTATGGAAGGAATGAACACGACTGGTAGAAAACTCGTTGCCACTAAACTCTATGAGGGTGTGCCACTTCCATTTTATCAGCCCACCGAAGAGGAGGGAGACTTTGAGCAGAACATGGTCCTGGTGGCCTGTGGACCATACACCACGTCTGACAGCATCACATATGACCCCCTGCTCGACCTGATCACCATCATCAACCACGACCAGCCAGACATCTGCATCCTGTTTGGCCCTTTCCTGGATGCTAAGCATGAACAGGTTGAGAACTGTCTGCTGACGAGTTCGTTCGAAGATGTTTTCAAGCAGTGTCTACGAACAATTGTCGAAGGGACTCGAAGCTCCGGCTCCCACCTCGTCTTTGTCCCGTCGCTGAGAGATGTCCAGCACGAGCCCGTGTACCCACAGCCACCTTTCAGCTACTCCGACCTGCCTCATGAGGACAGGAAGGTACCAGCGTCCCCTCCTCGACCAGCAGGCAGTCAGAATCAAATGCGCTGCAGGTGTCACAGCTCTGTCCCTGAAGTGGAGGGCGAACATGTCTTTTTGGGGCATG