Transcript asmbl_23209

Sequence
Transcript Sequence for observation asmbl_23209 of TGE0004390:
GGAGGCGAAGCCAGCCAGCTCAATGGCAGCGTCCTCGAGCGTAGGCTCCGCCTCTCGGAGGACAGGCCGCTGGGTACCGGGAAGGAGCGGCAACGCTTCAAGGAATGGGACAAGATGACACAGTGCCACTGAGGTCAAGGGTCAGGGCTCCTGCAGTGTCAGAGTCCTGGGGGGCCGGGTCTGGGACCCACCGCACCTCCCGTGCTTTTCATGCTGACAGATGCGCTGCCTGACTACACCCACGCTGCTTCGGGCCCTGGTCCAGGCCGCACACACAGGGCATTCTAGTGGCCGGAGCCTGCACAGCGGCGCAGTGGCAGCCACCTATAAGTACGTGAACGCGCAAGAGCCCTCCATGGACATGAAGTCGGTGACTGACCGGGCAGCTCAGACCCTGCTGTGGACGGAGCTCATCCGAGGCCTGGGCATGACCCTGAGCTACCTGTTCCGGGAGCCAGCCACCATCAACTACCCGTTTGAGAAGGGCCCGCTGAGCCCGCGTTTCCGCGGGGAGCACGCGCTGCGCCGTTACCCATCCGGGGAGGAGCGCTGTATCGCCTGCAAGCTTTGCGAGGCCGTCTGCCCCGCCCAGGCCATCACCATCGAAGCCGAGCCTCGGGCTGACGGCAGCCGCCGGACCACCCGCTACGACATCGACATGACCAAGTGCATCTACTGTGGCTTCTGCCAGGAGGCCTGCCCCGTGGACGCCATCGTCGAGGGCCCTAACTTCGAGTTCTCCACGGAGACGCATGAGGAGCTGCTGTACAACAAGGAGAAGCTGCTGAACAATGGGGACAAGTGGGAGGCTGAGATCGCTGCCAACATCCAGGCCGACTACCTCTACCGGTGACACTCCTGCCCGGCTGGCCCGCAGCCCCTGCTGCCCAATAAAGAAGCTCTGCTCTCCC