Transcript asmbl_23132

Sequence
Transcript Sequence for observation asmbl_23132 of TGE0004379:
CATTCGTGCCTCCCAGGGAAGGGACCCCTGGGCTCTTGGCTCCAGGGCCCTGCTCTGCAGCCCATGCAGGTATGCTGTGGGTGTATAAGGTGCCACAGCACGGATGCCCACTGCCCAGGTCTCCCATCTCTCCTAGGGAAGTGACAGCCCGGAGCGGGGCGGCCTGTGCCACTCTTCAAAGGGAAGCAGGTTGAGAGGAGAGTTCAGAAGGGGCGAAGGGCCTGGCTACCAGCTCCTGACAGGCACACCCTGCCTGGTCCAGGCCCTGGTGTCACCAGGGATGTAGGGGACTGTGCGTGCCCACCTGCTGGGCAGGGGCCTAGGCCCCTCCGCTGGTCTGGAGGAAGCACATGTCAGGGCTCTGAGACTTCGCCGACGTGCTCTTCACACCTGCACGTCTTAAAGCCCTGTCAAGGATGACAGCCAGGCTGGGCCTGCTTATCGCCCAGCTGCCCTAAGAGAAAGCCCCCTGAATCCCAAGGTTGGACCCTGCTGTGACATGCCCGCCATGAAGGCGCTCCTCAGCACACTCTGGCTTGCTCTGGCCTGTGGCTCTGTGCACACCACCCTGTCAAAGTCAGATGCCAAAAAGGCCGCCTCCAAGACACTGCTGGAGAAGACTCAGCCTTCAGAGAAGCCTGTCCAAGATCGGGGTCTGGTGGTGACGGACCCCAGACCCGAGGATGTGGTTCTCGAGCATCGTAGCTACTGCTCCGCAAAGGCACGGGAAAGGCACTTTGCTGGGGACGTCCTGGGCTACGTCACTCCATGGAACAGCCACGGCTACGACGTCGCCAAGGTGTTCGGAGGCAAGTTCACACAGATCTCGCCCGTGTGGCTGCAGCTGAAGCGGCGCGGCCGTGAGATGTTCGAGGTCACAGGCCTCCACGACGTGGACCAAGGGTGGATGCGGGCGGTCAGGAAGCAGGGCAGGGGCCTGCGCATAGTGCCTCGGCTCCTGTTTGAGGACTGGACCCGCGAGGATTTCCGGCGTGTGTGGGACAGTGAGGACGAGATAGAAGAGCTCAGCAAGGCCGTGGTCCAGGTTGCCAGGGACCAGCACTTTGATGGCTTCGTGGTGGAGGTCTGGAGCCAGCTGCTCAGCCAGAAGCACATGGGCCTCATCCACATGCTCACTCACATGGCCGAGGCGCTGCACCAGGCCCGGCTGCTGGCCATCCTCGTCATCCCACCGGCTGTCACCCCCGGGACTGAGCAGCTCGGCGTGTTCACGCACAAGGAGTTTGAGCAGCTGGCCCCCGTGCTGGACGGCTTCAGCCTCATGACTTACGACTACCCCGCAGTGCAGCAGCCTGGCCCCAATGCACCGCTGTCCTGGGTGCGAGCCTGTGTCCAGGTCCTGGACCCCAAGGCCAAGTGGCGGAGCAAGATCCTGCTGGGGCTCAACTTCTACGGCACAGACTACTCGACCTCCAGGGATGCCCGCGAGTCCGTCGTTGGGGCCAGGTACATTCAGACGCTGAAGGAGCACAGGCCCCGGATGGTGTGGGACAGCCAGGCAGCAGAGCACTTCTTCGAATATAAGAAAAGCCGCCGGGGAAGACATGTCATGTTCTACCCGACTCTGAAGTCCCTGCAGGTGCGGCTGGAGCTGGCCCGGGAGCTGGGCGTCGGGCTGTCCATCTGGGAGCTGGGCCAGGGCCTGGACTACTTCTACGACCTGCTGTAGGCCCGCCGCGGCCCAGTGCTCTTCTCAGCGGCATGCGAAATAC