Transcript asmbl_23131

Sequence
Transcript Sequence for observation asmbl_23131 of TGE0004379:
CGCGAGCGTCTTCCGGCTGCGCGCGAGAATTGTCCGGCCGGCATCCGGGACATGAAGCCCCCTGAATCCCAAGGTTGGACCCTGCTGTGACATGCCCGCCATGAAGGCGCTCCTCAGCACACTCTGGCTTGCTCTGGCCTGTGGCTCTGTGCACACCACCCTGTCAAAGTCAGATGCCAAAAAGGCCGCCTCCAAGACACTGCTGGAGAAGACTCAGCCTTCAGAGAAGCCTGTCCAAGATCGGGGTCTGGTGGTGACGGACCCCAGACCCGAGGATGTGGTTCTCGAGCATCGTAGCTACTGCTCCGCAAAGGCACGGGAAAGGCACTTTGCTGGGGACGTCCTGGGCTACGTCACTCCATGGAACAGCCACGGCTACGACGTCGCCAAGGTGTTCGGAGGCAAGTTCACACAGATCTCGCCCGTGTGGCTGCAGCTGAAGCGGCGCGGCCGTGAGATGTTCGAGGTCACAGGCCTCCACGACGTGGACCAAGGGTGGATGCGGGCGGTCAGGAAGCAGGGCAGGGGCCTGCGCATAGTGCCTCGGCTCCTGTTTGAGGACTGGACCCGCGAGGATTTCCGGCGTGTGTGGGACAGTGAGGACGAGATAGAAGAGCTCAGCAAGGCCGTGGTCCAGGTTGCCAGGGACCAGCACTTTGATGGCTTCGTGGTGGAGGTCTGGAGCCAGCTGCTCAGCCAGAAGCACATGGGCCTCATCCACATGCTCACTCACATGGCCGAGGCGCTGCACCAGGCCCGGCTGCTGGCCATCCTCGTCATCCCACCGGCTGTCACCCCCGGGACTGAGCAGCTCGGCGTGTTCACGCACAAGGAGTTTGAGCAGCTGGCCCCCGTGCTGGACGGCTTCAGCCTCATGACTTACGACTACCCCGCAGTGCAGCAGCCTGGCCCCAATGCACCGCTGTCCTGGGTGCGAGCCTGTGTCCAGGTCCTGGACCCCAAGGCCAAGTGGCGGAGCAAGATCCTGCTGGGGCTCAACTTCTACGGCACAGACTACTCGACCTCCAGGGATGCCCGCGAGTCCGTCGTTGGGGCCAGGTACATTCAGACGCTGAAGGAGCACAGGCCCCGGATGGTGTGGGACAGCCAGGCAGCAGAGCACTTCTTCGAATATAAGAAAAGCCGCCGGGGAAGACATGTCATGTTCTACCCGACTCTGAAGTCCCTGCAGGTGCGGCTGGAGCTGGCCCGGGAGCTGGGCGTCGGGCTGTCCATCTGGGAGCTGGGCCAGGGCCTGGACTACTTCTACGACCTGCTGTAGGCCCGCCGCGGCCCAGTGCTCTTCTCAGCGGCATGCGAAATAC