Transcript asmbl_22861

Sequence
Transcript Sequence for observation asmbl_22861 of TGE0004335:
GACATGTCCTTCCGAAAAGTGGTTCGGCAGAGCAAATTCCGGCATGTGTTTGGGCAGCCGGTCAAGAATGACCAGTGTTATGAGGACATCCGAGTGTCCCGTGTCACCTGGGACAGCACCTTCTGCGCTGTCAACCCCAAGTTCCTGGCAGTGATTGTGGAGGCCAGTGGTGGAGGCGCCTTCCTGGTGCTCCCTCTAAACAAGACGGGCCGCATTGACAAGGCCTACCCAACGGTGTGTGGGCACACGGGACCTGTCCTGGACATCGACTGGTGTCCCCACAACGACGAAGTCATCGCCAGCGGCTCGGAGGACTGCACAGTCATGGTGTGGCAGATCCCAGAGAATGGGCTGGCCTCCCCGCTGACAGAGCCCGTGGTGGTGCTGGAGGGGCACACCAAGCGAGTGGGCATCGTCACCTGGCACCCGACGGCCCGCAATGTGCTGCTCAGCGCAGGCTGTGACAATGTGGTGCTCATCTGGAACGTGGGCACGGCGGAGGAGCTGTACCGCTTGGACAGCCTGCACCCCGACCTCATCTACAATGTCAGCTGGAACCGCAACGGCAGCCTCTTCTGCTCCGCCTGCAAGGACAAGAGCGTGCGCATCATCGACCCCCGCCGGGGCATCCTGGTGGCGGAGCGAGAGAAGGCTCACGAGGGCGCCCGGCCCATGCGGGCCATCTTCCTGGCGGATGGCAAGGTGTTCACCACCGGCTTCAGCCGCATGAGCGAGCGGCAGCTGGCGCTCTGGGACCCAGAGAACCTCGAGGAACCAATGGCCCTGCAGGAGCTGGACTCTAGCAACGGGGCTCTGCTGCCCTTTTACGACCCTGACACCAGCGTGGTCTACGTCTGTGGCAAGGGCGATTCCAGCATCCGGTACTTTGAGATCACAGATGAGCCCCCCTACATCCACTTCCTGAACACGTTCACCAGCAAGGAGCCCCAGAGGGGCATGGGCAGCATGCCCAAGAGGGGCCTGGAGGTCAGCAAGTGCGAGATCGCCCGATTCTACAAACTGCACGAGCGCAAGTGCGAGCCTATTGTCATGACTGTGCCAAGAAAGTCGGACCTCTTCCAGGATGACCTGTACCCTGATACGGCCGGGCCCGAGGCGGCCCTGGAGGCAGAGGAGTGGGTGAGCGGGCGGGACGCCGACCCCATCCTCATCTCCCTGCGGGAGGCCTACGTGCCCAGCAAACAGCGGGACCTGAAGGTCAGCCGGCGGAACGTGTTGTCTGACAGCCGGCCTGCTGTGGCCCCGGGCTCCGCGCGCCTGGCGGCCTCCACACCTGCCACCTCCACCCATACGACTGCCCCCAGCAGCAGCCTCGCTGGGGCCGGGGAGGCTGGGAAACTGGAGGAGGTGATGCGGGAGCTGCGGGCACTGAGAGCGCTGGTCAAGGAGCAAGGGGAGCGCATCGGCCGCCTGGAGGAGCAGCTGGGCCGCATGGAGAATGGGGACGCCTAGGACCATAGGCCCAGTGGATGCCACGCCCCCTCACCTCCTCCTCCTCCACCCACTTCTCACTCAGCCTCTGCTGGCAGGCCACACCGATAGCTGGCTGCCCCCTGCCCCCTGCCCCCTGCCGAGGGCCTCTGGGGCAGGCTCGGGGCCAGCCCACACCCTGATCCATCCTGTGGGCCAGGCTGGAGCCACCGCCTGGCTTTTGTCTTTGTTACTGTGGAGGATTTTTGTACCAAGGCGAGCTTATGTGAGGGACCCTCTCTCCACACGCCCACCCGCCCCCTGCTCCCTCCCGGAGGAGTGGGAGGGATGGGCTCTATATTTTCATTCCAAATAAAATTCACTTTCTAAAA