Transcript asmbl_22760

Sequence
Transcript Sequence for observation asmbl_22760 of TGE0000661:
CCAGTTGCTGCGGACGCTCGGCCTGGCGTGGCGGATTGCTCGGACCTAACCGGCATCATCGTGCTCCGGGCTCTCCCCTCATGCACTATCGGGCGAGAGGAAGCAGGTCGGCTCCCGGCTCCCGGCTCCCGGCTGTCGGCGTCCGGAGCCTGCTCTGGGCTGAACCCTTAACGTTCAGAACTTTTCAGACTATCACAGTGTCTTGCAGTTCGTGCCCGTTGGGCTGGTCTGTTCCGGCGCACGTAAAATGTTTATTTGCCACTGTTGTGCACTTGCTATTGGATACAATCTTGGCGCAAAGACGGGCGATTTAGTAGTTTTGGGTGTTCGGTGACAGTTACTCTTTCGGATATTCGGACAAGGCTGACGTTGAGTTAGTTGGGTCGAAGGACCATGTTAATATAGTACAGTTGCTGCTGGATTTTCAGACGTTTGCGAAACGTCGGTGATTCGGCTCCCGTTCTGATAACTGACAGGCCGTAGCTGATATTTTTGTTTTGGTAGCTGGGGATACTGGGGGGACCAGTGTGCTTAGAGATAGGAAAACTTCGCGATGACAGAGGCAGAAAAAAAGATGTGTTCTCACAGTGGAACGATGGGGTGCCTGTTGACAATGACGGTAAAGCCGTGTCCTGTCTTCCCCAACAGCCATAATGGTGCGCATGAACGTCCTGGCCGACGCACTCAAGAGCATCAACAATGCTGAAAAGAGAGGCAAACGCCAGGTTCTCATTAGGCCGTGCTCCAAAGTCATCGTCCGGTTTCTGACTGTGATGATGAAGCATGGTTACATTGGCGAATTTGAAATCATCGATGATCACAGAGCTGGGAAAATTGTTGTGAACCTCACAGGCAGGTTAAACAAGTGTGGAGTGATCAGCCCCAGATTCGACGTGCAACTCAAAGATCTAGAAAAATGGCAGAACAACTTGCTCCCGTCCCGTCAGTTTGGTTTCATTGTACTGACAACTTCAGCGGGCATCATGGACCATGAAGAAGCAAGACGAAAACACACAGGAGGGAAAATCCTGGGATTCTTTTTCTAGGGATGTAATACATTTGTTCAAATAAAATGCCTCAATGGACTCTGGTGCTTCGCTCGGTCGTTTTGAACTTGACAGCAGAGTAGCGAGAGCGTCTGCGGCAGTGCAGCCTTTGCGTTAATTGGCGAAAGCCGTGTCCCTGAAGTGAACAAGAAAGTCTTGACTTGTGATAACTGAAGCCATCGTGCTCATGGCTCCCAGAGGAGAGTGTCGCCCAGGACGGTCGAATCTGGGTTGGGGTCCAGGTGGTGAAGCCTGTCCTTCTGAGGTCTTATGTTAACCCTGGA