Transcript asmbl_21491

Sequence
Transcript Sequence for observation asmbl_21491 of TGE0029639:
GTTGCCCTCGCCTTATTTGAATGGGAATAATCCCGGCGAAAATCGACATATGTGAGCTAGAGCAGATTTTCGAATCGTTGTACGCCTGGGTCGGTCGAGCGTGCAGTTCGGAGGGGATAGCGTGGTACCTTTCTGTTCAGGTGTCGCCCCGGGCAGCCTCACCCTTTTCTGGGGTTTCCGTGCGGCACAGGGCTCCGTTGGTGCGCATCCAAGATGGCGACGCTGTTGGCGGTAAATTCGGCTGCTAGTCTATGGGGTCCTTACAAAGACATTTGGCAAATGGTGGGAAATGCTCTCTGGAGAAGACAACCCGAAGCTGTCCACCTGCTCGACATGATTCTGAAGAAACATAAGCCAGACTTCATCTCACTGTTCAAAAATCCACCAAAAAATGTTCAACAGCATGAGAAGGTTCAGAAGGCTAGTACAGAGGGAGTCGCCATCCAGGGTCAGCAAGGGACCCGACTGCTTCCGGAACAGCTCATTAAAGAGGCCTTTATCCTCAGCGATCTTTTCGATATTGGAGAACTGGCTGCTGTGGAGCTTCTCCTTGCTGGAGAGCACCAACAGCCACATTTTCCTGGCCTCACCAGAGGATTAGTAGCTGTCCTCTTATATTGGGATGGAAAGCGATGCATTGCAAATTCCCTGAAAGCCTTAATACAGTCTAGACGAGGAAAGACATGGACCCTCGAACTCAGTCCAGAGCTGGTTTCCATGACAACACGCTTTACAGATGAGCTGATGCAGCAAGGGTTGACTTATAAAATCCTTACTCTGGTGTCACAGATTGATGTGAACAATGAGTTTGAGAAACTACAGCGTGAGAGAGGTTTGGGCAGCGAAAAACATCGCAAAGAGGTTTCCGATCTCATCAAGGAGTGCAGGCAGTCTCTGGCAGAAAGCCTTTTTGCCTGGGCTTGCCAGTCACCATTAGGCAAAGATGACACTCTACTCCTTATTGGACATTGGAAAGAGTTTTTTTAAGAGTGACAGTTGAGGCTAATGGCTCATTGGATACAGTGAATCTGGCTCTTCTTATGGCACTTCTGTACTGTTTTGACATCAGTTTTCTAGAACAGAGCACAGAGGAACGTGATGACATGATTCATCAACTTCCACTATTGACAGAGAGACAGTATATTGCAACAGTTCACTCTCGCCTTCAAGACTCACAGCCTTGGAAACTGCCTGGACTGCAAGCCACTGTTAGACTTGCCTGGGCACTGGCACTGAGGGGAATATCTCAGCTACCTGATGTGACAGCTCTGGCTGAATTCACAGAAGCAGATGAAGCAATGGCAGAGCTCGCAATTGCTGACAATGTTTTCCTGTTCCTCACTGAATCCGTAGTAGTGTCAGAAAACTTCTATCAGGACGAATTTTATATTCGTAGAATCCATAATCTCATCACGGATTTCCTTGCACTTATGCCAATGAAGGTGAAGCAGTTGAGGAATCGGGCAGATGAAGATGCTCGAATGATTCACATGAGTATGCAGATGGGTAATGAACCCCCCATTTCACTTAGAAGGGATCTGGAACACTTAATGCTATTGATTGGTGAGCTATATAAAAAGAACCCTTTTAATTTAGAGCTTGCTCTGGAATATTGGTGT